ID: 938292561

View in Genome Browser
Species Human (GRCh38)
Location 2:130157812-130157834
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292561_938292569 8 Left 938292561 2:130157812-130157834 CCAGGGTCTCCCACCTGCCTCCC No data
Right 938292569 2:130157843-130157865 GCAGAAAGCACATGGAACCCAGG No data
938292561_938292568 0 Left 938292561 2:130157812-130157834 CCAGGGTCTCCCACCTGCCTCCC No data
Right 938292568 2:130157835-130157857 AAGTGTGTGCAGAAAGCACATGG No data
938292561_938292570 13 Left 938292561 2:130157812-130157834 CCAGGGTCTCCCACCTGCCTCCC No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938292561 Original CRISPR GGGAGGCAGGTGGGAGACCC TGG (reversed) Intronic