ID: 938292562

View in Genome Browser
Species Human (GRCh38)
Location 2:130157821-130157843
Sequence CACACACTTGGGAGGCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292562_938292568 -9 Left 938292562 2:130157821-130157843 CCCACCTGCCTCCCAAGTGTGTG No data
Right 938292568 2:130157835-130157857 AAGTGTGTGCAGAAAGCACATGG No data
938292562_938292570 4 Left 938292562 2:130157821-130157843 CCCACCTGCCTCCCAAGTGTGTG No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data
938292562_938292569 -1 Left 938292562 2:130157821-130157843 CCCACCTGCCTCCCAAGTGTGTG No data
Right 938292569 2:130157843-130157865 GCAGAAAGCACATGGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938292562 Original CRISPR CACACACTTGGGAGGCAGGT GGG (reversed) Intronic