ID: 938292563

View in Genome Browser
Species Human (GRCh38)
Location 2:130157822-130157844
Sequence GCACACACTTGGGAGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292563_938292569 -2 Left 938292563 2:130157822-130157844 CCACCTGCCTCCCAAGTGTGTGC No data
Right 938292569 2:130157843-130157865 GCAGAAAGCACATGGAACCCAGG No data
938292563_938292570 3 Left 938292563 2:130157822-130157844 CCACCTGCCTCCCAAGTGTGTGC No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data
938292563_938292568 -10 Left 938292563 2:130157822-130157844 CCACCTGCCTCCCAAGTGTGTGC No data
Right 938292568 2:130157835-130157857 AAGTGTGTGCAGAAAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938292563 Original CRISPR GCACACACTTGGGAGGCAGG TGG (reversed) Intronic
No off target data available for this crispr