ID: 938292564

View in Genome Browser
Species Human (GRCh38)
Location 2:130157825-130157847
Sequence TCTGCACACACTTGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292564_938292569 -5 Left 938292564 2:130157825-130157847 CCTGCCTCCCAAGTGTGTGCAGA No data
Right 938292569 2:130157843-130157865 GCAGAAAGCACATGGAACCCAGG No data
938292564_938292574 30 Left 938292564 2:130157825-130157847 CCTGCCTCCCAAGTGTGTGCAGA No data
Right 938292574 2:130157878-130157900 GACCTGTAATTCCAGCACTTTGG 0: 16
1: 3808
2: 94655
3: 320956
4: 241482
938292564_938292570 0 Left 938292564 2:130157825-130157847 CCTGCCTCCCAAGTGTGTGCAGA No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938292564 Original CRISPR TCTGCACACACTTGGGAGGC AGG (reversed) Intronic
No off target data available for this crispr