ID: 938292566

View in Genome Browser
Species Human (GRCh38)
Location 2:130157832-130157854
Sequence TGTGCTTTCTGCACACACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292566_938292570 -7 Left 938292566 2:130157832-130157854 CCCAAGTGTGTGCAGAAAGCACA No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data
938292566_938292575 24 Left 938292566 2:130157832-130157854 CCCAAGTGTGTGCAGAAAGCACA No data
Right 938292575 2:130157879-130157901 ACCTGTAATTCCAGCACTTTGGG 0: 3111
1: 86006
2: 313232
3: 241847
4: 148165
938292566_938292574 23 Left 938292566 2:130157832-130157854 CCCAAGTGTGTGCAGAAAGCACA No data
Right 938292574 2:130157878-130157900 GACCTGTAATTCCAGCACTTTGG 0: 16
1: 3808
2: 94655
3: 320956
4: 241482
938292566_938292577 27 Left 938292566 2:130157832-130157854 CCCAAGTGTGTGCAGAAAGCACA No data
Right 938292577 2:130157882-130157904 TGTAATTCCAGCACTTTGGGAGG 0: 11596
1: 306145
2: 263594
3: 149163
4: 135954

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938292566 Original CRISPR TGTGCTTTCTGCACACACTT GGG (reversed) Intronic
No off target data available for this crispr