ID: 938292567

View in Genome Browser
Species Human (GRCh38)
Location 2:130157833-130157855
Sequence ATGTGCTTTCTGCACACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292567_938292575 23 Left 938292567 2:130157833-130157855 CCAAGTGTGTGCAGAAAGCACAT No data
Right 938292575 2:130157879-130157901 ACCTGTAATTCCAGCACTTTGGG No data
938292567_938292570 -8 Left 938292567 2:130157833-130157855 CCAAGTGTGTGCAGAAAGCACAT No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data
938292567_938292577 26 Left 938292567 2:130157833-130157855 CCAAGTGTGTGCAGAAAGCACAT No data
Right 938292577 2:130157882-130157904 TGTAATTCCAGCACTTTGGGAGG No data
938292567_938292574 22 Left 938292567 2:130157833-130157855 CCAAGTGTGTGCAGAAAGCACAT No data
Right 938292574 2:130157878-130157900 GACCTGTAATTCCAGCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938292567 Original CRISPR ATGTGCTTTCTGCACACACT TGG (reversed) Intronic