ID: 938292568

View in Genome Browser
Species Human (GRCh38)
Location 2:130157835-130157857
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292561_938292568 0 Left 938292561 2:130157812-130157834 CCAGGGTCTCCCACCTGCCTCCC No data
Right 938292568 2:130157835-130157857 AAGTGTGTGCAGAAAGCACATGG No data
938292560_938292568 15 Left 938292560 2:130157797-130157819 CCACAAGCTCTGGATCCAGGGTC No data
Right 938292568 2:130157835-130157857 AAGTGTGTGCAGAAAGCACATGG No data
938292563_938292568 -10 Left 938292563 2:130157822-130157844 CCACCTGCCTCCCAAGTGTGTGC No data
Right 938292568 2:130157835-130157857 AAGTGTGTGCAGAAAGCACATGG No data
938292555_938292568 25 Left 938292555 2:130157787-130157809 CCAGCATCACCCACAAGCTCTGG No data
Right 938292568 2:130157835-130157857 AAGTGTGTGCAGAAAGCACATGG No data
938292562_938292568 -9 Left 938292562 2:130157821-130157843 CCCACCTGCCTCCCAAGTGTGTG No data
Right 938292568 2:130157835-130157857 AAGTGTGTGCAGAAAGCACATGG No data
938292559_938292568 16 Left 938292559 2:130157796-130157818 CCCACAAGCTCTGGATCCAGGGT No data
Right 938292568 2:130157835-130157857 AAGTGTGTGCAGAAAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type