ID: 938292569

View in Genome Browser
Species Human (GRCh38)
Location 2:130157843-130157865
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292565_938292569 -9 Left 938292565 2:130157829-130157851 CCTCCCAAGTGTGTGCAGAAAGC No data
Right 938292569 2:130157843-130157865 GCAGAAAGCACATGGAACCCAGG No data
938292562_938292569 -1 Left 938292562 2:130157821-130157843 CCCACCTGCCTCCCAAGTGTGTG No data
Right 938292569 2:130157843-130157865 GCAGAAAGCACATGGAACCCAGG No data
938292560_938292569 23 Left 938292560 2:130157797-130157819 CCACAAGCTCTGGATCCAGGGTC No data
Right 938292569 2:130157843-130157865 GCAGAAAGCACATGGAACCCAGG No data
938292563_938292569 -2 Left 938292563 2:130157822-130157844 CCACCTGCCTCCCAAGTGTGTGC No data
Right 938292569 2:130157843-130157865 GCAGAAAGCACATGGAACCCAGG No data
938292559_938292569 24 Left 938292559 2:130157796-130157818 CCCACAAGCTCTGGATCCAGGGT No data
Right 938292569 2:130157843-130157865 GCAGAAAGCACATGGAACCCAGG No data
938292564_938292569 -5 Left 938292564 2:130157825-130157847 CCTGCCTCCCAAGTGTGTGCAGA No data
Right 938292569 2:130157843-130157865 GCAGAAAGCACATGGAACCCAGG No data
938292561_938292569 8 Left 938292561 2:130157812-130157834 CCAGGGTCTCCCACCTGCCTCCC No data
Right 938292569 2:130157843-130157865 GCAGAAAGCACATGGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type