ID: 938292570

View in Genome Browser
Species Human (GRCh38)
Location 2:130157848-130157870
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292566_938292570 -7 Left 938292566 2:130157832-130157854 CCCAAGTGTGTGCAGAAAGCACA No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data
938292563_938292570 3 Left 938292563 2:130157822-130157844 CCACCTGCCTCCCAAGTGTGTGC No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data
938292561_938292570 13 Left 938292561 2:130157812-130157834 CCAGGGTCTCCCACCTGCCTCCC No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data
938292560_938292570 28 Left 938292560 2:130157797-130157819 CCACAAGCTCTGGATCCAGGGTC No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data
938292562_938292570 4 Left 938292562 2:130157821-130157843 CCCACCTGCCTCCCAAGTGTGTG No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data
938292565_938292570 -4 Left 938292565 2:130157829-130157851 CCTCCCAAGTGTGTGCAGAAAGC No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data
938292567_938292570 -8 Left 938292567 2:130157833-130157855 CCAAGTGTGTGCAGAAAGCACAT No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data
938292559_938292570 29 Left 938292559 2:130157796-130157818 CCCACAAGCTCTGGATCCAGGGT No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data
938292564_938292570 0 Left 938292564 2:130157825-130157847 CCTGCCTCCCAAGTGTGTGCAGA No data
Right 938292570 2:130157848-130157870 AAGCACATGGAACCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type