ID: 938292571

View in Genome Browser
Species Human (GRCh38)
Location 2:130157860-130157882
Sequence AGGTCTGAGGCACCACACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2107
Summary {0: 1, 1: 4, 2: 74, 3: 409, 4: 1619}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292571_938292577 -1 Left 938292571 2:130157860-130157882 CCCAGGTGTGGTGCCTCAGACCT 0: 1
1: 4
2: 74
3: 409
4: 1619
Right 938292577 2:130157882-130157904 TGTAATTCCAGCACTTTGGGAGG No data
938292571_938292580 8 Left 938292571 2:130157860-130157882 CCCAGGTGTGGTGCCTCAGACCT 0: 1
1: 4
2: 74
3: 409
4: 1619
Right 938292580 2:130157891-130157913 AGCACTTTGGGAGGCCAAGGTGG No data
938292571_938292575 -4 Left 938292571 2:130157860-130157882 CCCAGGTGTGGTGCCTCAGACCT 0: 1
1: 4
2: 74
3: 409
4: 1619
Right 938292575 2:130157879-130157901 ACCTGTAATTCCAGCACTTTGGG No data
938292571_938292578 5 Left 938292571 2:130157860-130157882 CCCAGGTGTGGTGCCTCAGACCT 0: 1
1: 4
2: 74
3: 409
4: 1619
Right 938292578 2:130157888-130157910 TCCAGCACTTTGGGAGGCCAAGG No data
938292571_938292574 -5 Left 938292571 2:130157860-130157882 CCCAGGTGTGGTGCCTCAGACCT 0: 1
1: 4
2: 74
3: 409
4: 1619
Right 938292574 2:130157878-130157900 GACCTGTAATTCCAGCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938292571 Original CRISPR AGGTCTGAGGCACCACACCT GGG (reversed) Intronic