ID: 938292572

View in Genome Browser
Species Human (GRCh38)
Location 2:130157861-130157883
Sequence CAGGTCTGAGGCACCACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133539
Summary {0: 1, 1: 82, 2: 5612, 3: 31619, 4: 96225}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292572_938292577 -2 Left 938292572 2:130157861-130157883 CCAGGTGTGGTGCCTCAGACCTG 0: 1
1: 82
2: 5612
3: 31619
4: 96225
Right 938292577 2:130157882-130157904 TGTAATTCCAGCACTTTGGGAGG No data
938292572_938292580 7 Left 938292572 2:130157861-130157883 CCAGGTGTGGTGCCTCAGACCTG 0: 1
1: 82
2: 5612
3: 31619
4: 96225
Right 938292580 2:130157891-130157913 AGCACTTTGGGAGGCCAAGGTGG No data
938292572_938292578 4 Left 938292572 2:130157861-130157883 CCAGGTGTGGTGCCTCAGACCTG 0: 1
1: 82
2: 5612
3: 31619
4: 96225
Right 938292578 2:130157888-130157910 TCCAGCACTTTGGGAGGCCAAGG No data
938292572_938292574 -6 Left 938292572 2:130157861-130157883 CCAGGTGTGGTGCCTCAGACCTG 0: 1
1: 82
2: 5612
3: 31619
4: 96225
Right 938292574 2:130157878-130157900 GACCTGTAATTCCAGCACTTTGG No data
938292572_938292575 -5 Left 938292572 2:130157861-130157883 CCAGGTGTGGTGCCTCAGACCTG 0: 1
1: 82
2: 5612
3: 31619
4: 96225
Right 938292575 2:130157879-130157901 ACCTGTAATTCCAGCACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938292572 Original CRISPR CAGGTCTGAGGCACCACACC TGG (reversed) Intronic