ID: 938292573

View in Genome Browser
Species Human (GRCh38)
Location 2:130157873-130157895
Sequence GTGCTGGAATTACAGGTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7487
Summary {0: 1, 1: 60, 2: 1049, 3: 3192, 4: 3185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292573_938292580 -5 Left 938292573 2:130157873-130157895 CCTCAGACCTGTAATTCCAGCAC 0: 1
1: 60
2: 1049
3: 3192
4: 3185
Right 938292580 2:130157891-130157913 AGCACTTTGGGAGGCCAAGGTGG No data
938292573_938292578 -8 Left 938292573 2:130157873-130157895 CCTCAGACCTGTAATTCCAGCAC 0: 1
1: 60
2: 1049
3: 3192
4: 3185
Right 938292578 2:130157888-130157910 TCCAGCACTTTGGGAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938292573 Original CRISPR GTGCTGGAATTACAGGTCTG AGG (reversed) Intronic