ID: 938292574

View in Genome Browser
Species Human (GRCh38)
Location 2:130157878-130157900
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292564_938292574 30 Left 938292564 2:130157825-130157847 CCTGCCTCCCAAGTGTGTGCAGA No data
Right 938292574 2:130157878-130157900 GACCTGTAATTCCAGCACTTTGG No data
938292565_938292574 26 Left 938292565 2:130157829-130157851 CCTCCCAAGTGTGTGCAGAAAGC No data
Right 938292574 2:130157878-130157900 GACCTGTAATTCCAGCACTTTGG No data
938292566_938292574 23 Left 938292566 2:130157832-130157854 CCCAAGTGTGTGCAGAAAGCACA No data
Right 938292574 2:130157878-130157900 GACCTGTAATTCCAGCACTTTGG No data
938292567_938292574 22 Left 938292567 2:130157833-130157855 CCAAGTGTGTGCAGAAAGCACAT No data
Right 938292574 2:130157878-130157900 GACCTGTAATTCCAGCACTTTGG No data
938292571_938292574 -5 Left 938292571 2:130157860-130157882 CCCAGGTGTGGTGCCTCAGACCT 0: 1
1: 4
2: 74
3: 409
4: 1619
Right 938292574 2:130157878-130157900 GACCTGTAATTCCAGCACTTTGG No data
938292572_938292574 -6 Left 938292572 2:130157861-130157883 CCAGGTGTGGTGCCTCAGACCTG 0: 1
1: 82
2: 5612
3: 31619
4: 96225
Right 938292574 2:130157878-130157900 GACCTGTAATTCCAGCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type