ID: 938292575

View in Genome Browser
Species Human (GRCh38)
Location 2:130157879-130157901
Sequence ACCTGTAATTCCAGCACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292567_938292575 23 Left 938292567 2:130157833-130157855 CCAAGTGTGTGCAGAAAGCACAT No data
Right 938292575 2:130157879-130157901 ACCTGTAATTCCAGCACTTTGGG No data
938292565_938292575 27 Left 938292565 2:130157829-130157851 CCTCCCAAGTGTGTGCAGAAAGC No data
Right 938292575 2:130157879-130157901 ACCTGTAATTCCAGCACTTTGGG No data
938292571_938292575 -4 Left 938292571 2:130157860-130157882 CCCAGGTGTGGTGCCTCAGACCT 0: 1
1: 4
2: 74
3: 409
4: 1619
Right 938292575 2:130157879-130157901 ACCTGTAATTCCAGCACTTTGGG No data
938292566_938292575 24 Left 938292566 2:130157832-130157854 CCCAAGTGTGTGCAGAAAGCACA No data
Right 938292575 2:130157879-130157901 ACCTGTAATTCCAGCACTTTGGG No data
938292572_938292575 -5 Left 938292572 2:130157861-130157883 CCAGGTGTGGTGCCTCAGACCTG 0: 1
1: 82
2: 5612
3: 31619
4: 96225
Right 938292575 2:130157879-130157901 ACCTGTAATTCCAGCACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938292575 Original CRISPR ACCTGTAATTCCAGCACTTT GGG Intronic