ID: 938292578

View in Genome Browser
Species Human (GRCh38)
Location 2:130157888-130157910
Sequence TCCAGCACTTTGGGAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938292573_938292578 -8 Left 938292573 2:130157873-130157895 CCTCAGACCTGTAATTCCAGCAC 0: 1
1: 60
2: 1049
3: 3192
4: 3185
Right 938292578 2:130157888-130157910 TCCAGCACTTTGGGAGGCCAAGG No data
938292571_938292578 5 Left 938292571 2:130157860-130157882 CCCAGGTGTGGTGCCTCAGACCT 0: 1
1: 4
2: 74
3: 409
4: 1619
Right 938292578 2:130157888-130157910 TCCAGCACTTTGGGAGGCCAAGG No data
938292572_938292578 4 Left 938292572 2:130157861-130157883 CCAGGTGTGGTGCCTCAGACCTG 0: 1
1: 82
2: 5612
3: 31619
4: 96225
Right 938292578 2:130157888-130157910 TCCAGCACTTTGGGAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938292578 Original CRISPR TCCAGCACTTTGGGAGGCCA AGG Intronic