ID: 938293251

View in Genome Browser
Species Human (GRCh38)
Location 2:130161470-130161492
Sequence CTGCGCTGGCCCGCGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 2, 1: 0, 2: 2, 3: 23, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938293251_938293254 -3 Left 938293251 2:130161470-130161492 CCAGCAGCCGCGGGCCAGCGCAG 0: 2
1: 0
2: 2
3: 23
4: 203
Right 938293254 2:130161490-130161512 CAGCACCCCCCTCCACAACCAGG No data
938293251_938293258 3 Left 938293251 2:130161470-130161492 CCAGCAGCCGCGGGCCAGCGCAG 0: 2
1: 0
2: 2
3: 23
4: 203
Right 938293258 2:130161496-130161518 CCCCCTCCACAACCAGGCCAGGG No data
938293251_938293263 9 Left 938293251 2:130161470-130161492 CCAGCAGCCGCGGGCCAGCGCAG 0: 2
1: 0
2: 2
3: 23
4: 203
Right 938293263 2:130161502-130161524 CCACAACCAGGCCAGGGCTGTGG No data
938293251_938293256 2 Left 938293251 2:130161470-130161492 CCAGCAGCCGCGGGCCAGCGCAG 0: 2
1: 0
2: 2
3: 23
4: 203
Right 938293256 2:130161495-130161517 CCCCCCTCCACAACCAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938293251 Original CRISPR CTGCGCTGGCCCGCGGCTGC TGG (reversed) Intronic
900171931 1:1273577-1273599 CAGCGGCGGCCCGGGGCTGCTGG - Intronic
900313314 1:2045034-2045056 CTGCGCGGGTCCCGGGCTGCTGG - Intergenic
900349240 1:2227215-2227237 CTGCGCGGGCCGGGGGCTTCGGG - Intergenic
900408475 1:2502609-2502631 CAGCCCGGGCCCGGGGCTGCTGG - Intronic
900603696 1:3514672-3514694 CTCCTCGGGCCCGTGGCTGCAGG - Exonic
901057478 1:6455384-6455406 CGGTGCTGGCCCGGGGCTGGAGG + Intronic
903161302 1:21491058-21491080 CTGCTCTGGCCCAGGGCTCCAGG - Intergenic
903229254 1:21911803-21911825 CTGGGCTGGCCGGCAGCTGAGGG - Intronic
903857573 1:26345879-26345901 CTGCCCAGGCCCACGGCTGGCGG - Exonic
904089509 1:27934974-27934996 CTGGGCTGGCCCGAGGAGGCAGG - Exonic
904769017 1:32870761-32870783 CTGCGCCGCCCCGGGCCTGCCGG - Exonic
904847325 1:33430437-33430459 CTGCGCTGTCACGCCGCGGCTGG + Intronic
905215085 1:36401163-36401185 CTGCTCTGGCCCGTGGTTCCTGG + Intergenic
907427605 1:54390763-54390785 CGGCCCTGGCCCGCAGCTCCGGG - Intronic
909170029 1:72282990-72283012 CTGCGCCGGCCGCCGGCTCCCGG + Intergenic
909544603 1:76831836-76831858 CTGGGCAGGCCTGGGGCTGCTGG - Intergenic
911997732 1:104788280-104788302 TTGCTCTGGCCCGCGGTTCCTGG + Intergenic
913300763 1:117367039-117367061 CTCCGGTGGCTCGCAGCTGCTGG - Intergenic
915360933 1:155285908-155285930 GTGTGCTGGCCCGCGGCGCCCGG + Exonic
915367329 1:155323526-155323548 CGGCGCCGGGCTGCGGCTGCTGG + Intronic
919724564 1:200873406-200873428 CTGCGCGGGCGCGCTGCTGCTGG + Exonic
919806812 1:201385417-201385439 CAGGGCTGGCCCTGGGCTGCAGG - Intronic
921650724 1:217674747-217674769 CTGCTCTGGCCTGTGGCTCCAGG + Intronic
922043111 1:221916391-221916413 CTGCGCTGGCACACAGCAGCTGG + Intergenic
922044182 1:221927832-221927854 CTGCACTGTGCAGCGGCTGCTGG - Intergenic
922554705 1:226523845-226523867 CTGGGGTGGCCTGCGGATGCAGG + Intergenic
922699505 1:227750610-227750632 CTGCCCTGGCTCGCTGCTGAGGG + Intronic
922774466 1:228208378-228208400 CTAGGCTGGCCTGGGGCTGCGGG + Intronic
922867338 1:228871467-228871489 ATGCACTGGCCAGGGGCTGCAGG - Intergenic
1062932671 10:1363272-1363294 TTGCGCTCGCCCGGGGCCGCGGG + Exonic
1064148160 10:12841700-12841722 CTGCTCTGGCCTGAGGCGGCCGG - Intergenic
1066126321 10:32346576-32346598 CCCCGCTGGGCCGCGGCGGCCGG + Intronic
1067258610 10:44666688-44666710 CTGCTCTGGCCTGTGGCTCCTGG + Intergenic
1068669349 10:59708896-59708918 CCGCGCTCGCCCAGGGCTGCCGG + Intronic
1074088344 10:110225883-110225905 CCGCACCCGCCCGCGGCTGCCGG - Intronic
1074370493 10:112896944-112896966 CTGCACTGGCCCGTGCCTGGAGG + Intergenic
1075054465 10:119207393-119207415 CTGGGCTGGCGCGCGGCTGTCGG - Intergenic
1075937049 10:126351445-126351467 CTGCTCTGGCCCTCTGGTGCTGG + Intronic
1076542516 10:131223191-131223213 CTGCACAGTCCAGCGGCTGCTGG - Intronic
1076701520 10:132275621-132275643 CTGCGCTGGCCCCTGGCCACTGG - Intronic
1076994347 11:290861-290883 CTCCCCTGGCCTGCAGCTGCAGG - Exonic
1077148050 11:1054605-1054627 CCGCCCTGGCCCGCAGCTGTTGG + Intergenic
1077416423 11:2426299-2426321 CTGGGCTGGCCGGCGGGGGCGGG - Intergenic
1081702001 11:45158202-45158224 CTGCCCTGTCCCAGGGCTGCTGG + Intronic
1083631523 11:64097813-64097835 CTGCTCAGGCCTGGGGCTGCAGG + Intronic
1083822562 11:65181489-65181511 CCGGGCGGGCCCGGGGCTGCGGG + Exonic
1084165741 11:67373933-67373955 CGGCGCTGTCCCCCGGCTCCTGG - Intronic
1085640282 11:78188914-78188936 CGGCGCGGCCCCGGGGCTGCGGG - Exonic
1085784458 11:79438442-79438464 CTGCGCTAGCCCGGCGCTGATGG - Intronic
1086409984 11:86535363-86535385 TTGCCCTGGCCTGCTGCTGCAGG - Intronic
1088746014 11:112805748-112805770 CTGCCCTGGCCAGTGGCTGCCGG - Intergenic
1089253034 11:117178957-117178979 CGGCCCTGGCCCGGGGCTCCAGG + Exonic
1089559722 11:119337777-119337799 CTGGGCTGGAGTGCGGCTGCGGG + Intergenic
1091405001 12:203671-203693 CCGGGCTGACCCGGGGCTGCCGG - Intronic
1094017911 12:25884301-25884323 CTGCTCTGGCCCGCTGCTGCGGG + Intergenic
1094807951 12:34109119-34109141 CTGAGCTGGCCCAAGGTTGCAGG + Intergenic
1096146528 12:49282599-49282621 CTGTGCTGGCCCCTGGCTGGAGG - Intergenic
1097648023 12:62260166-62260188 CTCCTCTGGCCCGGGACTGCCGG - Intronic
1104757412 12:131277842-131277864 TTGCTCTGCCCCACGGCTGCAGG + Intergenic
1104866941 12:131961366-131961388 TTGGGCTGGCCAGGGGCTGCAGG - Exonic
1104885490 12:132104734-132104756 TTGGGCTGGCCAGGGGCTGCAGG - Exonic
1104887169 12:132117478-132117500 CTGCGCTGGCCTGTGACTGGAGG - Intronic
1104887198 12:132117597-132117619 CTGCGCTGGCCTGTGACTGGAGG - Intronic
1105768082 13:23579921-23579943 CTGAGCCAGCGCGCGGCTGCAGG + Intronic
1111197578 13:84894858-84894880 CTGCGCTCGCCGGCCGGTGCGGG - Intergenic
1112290967 13:98143588-98143610 CAGCGCACGGCCGCGGCTGCGGG + Intronic
1122068489 14:99189957-99189979 CTGGGCTGGCCCGCAGAAGCAGG + Intronic
1122275213 14:100587446-100587468 CTGCGCGGGGCCGGGGCTGGCGG - Intergenic
1122414734 14:101543452-101543474 CTGAGCTGACCTGCAGCTGCAGG - Intergenic
1123004374 14:105314436-105314458 CGGCCCTTGCCCGCGGCTCCCGG + Exonic
1123034594 14:105466749-105466771 CAGCGCCCGCCCGCGGCTCCAGG - Intronic
1124340314 15:28886024-28886046 CCGCACCGGCCTGCGGCTGCCGG - Exonic
1126483801 15:49156429-49156451 CTGCTCTGGCAGGAGGCTGCTGG - Intronic
1127868127 15:63048298-63048320 CTGCGCATGCTCGCGGCGGCGGG - Intronic
1127900709 15:63338939-63338961 CTGCTCTTGCCCTCAGCTGCTGG - Exonic
1129672660 15:77615900-77615922 CTGTGCTTGCTCCCGGCTGCAGG - Exonic
1130305328 15:82709427-82709449 CCGCGCTGGGCCGGGGCTCCAGG + Intronic
1131055385 15:89371695-89371717 CTGGGCTGTCCCGCGGCTCATGG - Intergenic
1131089834 15:89615351-89615373 CTGCCCTGTCCAGAGGCTGCTGG + Intronic
1132625342 16:888936-888958 CTGCGCTGGCCCTGGGATCCTGG + Intronic
1132670283 16:1099713-1099735 CTGGGCGGTCCCGGGGCTGCAGG + Intergenic
1137673537 16:50292669-50292691 CTGCGTTGGCCAGCAGCTGCGGG - Exonic
1137811720 16:51359128-51359150 CTGGGCTGGCCTCCTGCTGCTGG + Intergenic
1138651460 16:58463684-58463706 CTCCGCGTGCCCGCGGCTGCAGG - Intronic
1141175123 16:81713649-81713671 CTGCTCTGCCCCGCAGCAGCTGG + Intergenic
1142137894 16:88459971-88459993 CTGCGCTGGCCCCAGGTTCCAGG + Intronic
1142849401 17:2696994-2697016 CTCTGCTGGCCCACGGCTCCCGG + Intronic
1143216490 17:5229038-5229060 CTGCGCTGGCCATTGGCTACTGG + Intronic
1144756026 17:17681329-17681351 CTGCGCTCGCTCGCGGCCCCGGG - Intergenic
1144759365 17:17698638-17698660 CTGAGCTGGCCTGGGGGTGCAGG - Intronic
1146329686 17:31917216-31917238 CTGCCCTGCCCGGCGGCGGCCGG + Intergenic
1146955621 17:36935059-36935081 CTGCCCTGACCCGTGGGTGCCGG - Intergenic
1147319442 17:39637031-39637053 CTGCGCAGGGCCGGGGCTGGAGG + Intergenic
1147615122 17:41822950-41822972 CTGAGCTGACCCTGGGCTGCTGG + Exonic
1148566025 17:48633562-48633584 CTGGACTGGGCCGCGGCCGCTGG - Intronic
1149567708 17:57651709-57651731 CTGGGCTGGCCCACTGCTCCTGG - Intronic
1149610364 17:57954893-57954915 CGGCGCTGGCCCGCGCCCCCCGG + Intronic
1150702249 17:67458008-67458030 CAGTGCTGGCCCACTGCTGCAGG + Intronic
1150737218 17:67751209-67751231 CTGCTCTGGCCCAAGGCTCCAGG - Intergenic
1151763801 17:76121998-76122020 CTGCGCTGGGCAGCGGGTGCGGG + Intergenic
1152073249 17:78144460-78144482 CTGCCCAGGCCCTGGGCTGCTGG - Intergenic
1152075667 17:78158264-78158286 CTGCCCTGGTCCTAGGCTGCTGG + Intronic
1152396265 17:80035652-80035674 CTCCCCGGTCCCGCGGCTGCAGG + Intronic
1152711084 17:81870894-81870916 ACGCGATGGACCGCGGCTGCCGG + Intronic
1153382251 18:4454000-4454022 CCGCGCTCGCCCCCGGCTGCAGG - Intronic
1153688090 18:7566839-7566861 CTGCGCTGCTCGGCGGCTGCGGG - Exonic
1154165908 18:12014336-12014358 CTGCAATGGCCAGCGGCTCCGGG + Exonic
1160721500 19:599061-599083 CTGGGCTGGCACCCGCCTGCTGG - Intronic
1160967552 19:1753313-1753335 CTGCGCCCGCCCGCGCCCGCTGG - Exonic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161326815 19:3668062-3668084 CTGCGCTGACCGGAGGCTGCGGG - Intronic
1161764602 19:6199745-6199767 CTGCGCCTGCGCGCCGCTGCAGG + Intergenic
1162299345 19:9835432-9835454 CTGCGCGGGCCCGCGTAAGCAGG + Intronic
1162369669 19:10271167-10271189 CAGCGCGGGCCGGGGGCTGCTGG - Exonic
1162441067 19:10692287-10692309 CTGCGCGGGCCTGAGACTGCTGG + Exonic
1162932041 19:13962259-13962281 CTGCGCCGGCCCGGGGCTCAGGG + Exonic
1163776142 19:19219027-19219049 CTGCGCTTGGCCGTGGCTGCAGG - Exonic
1164578115 19:29417886-29417908 CTGTGCTGGTCAGCGGCTGGAGG - Intergenic
1165220227 19:34310383-34310405 CTGCACTGGCCCGAGGCAGTGGG - Intronic
1165427310 19:35753278-35753300 CTGCCCTGGCACCAGGCTGCTGG - Intronic
1165447143 19:35862562-35862584 CTGGGGTGGCCCTCTGCTGCTGG + Exonic
1165721491 19:38082425-38082447 CTGCGCGGGGCCTCGGCGGCGGG + Exonic
1166043815 19:40218019-40218041 GCGCGCCGGCCCGGGGCTGCTGG + Exonic
1166333250 19:42090725-42090747 CTTCGCTGGCCCAGGGCTGGGGG + Exonic
1166858027 19:45792815-45792837 CGGCGCGGGCCAGCGGCTTCCGG - Intergenic
1167311250 19:48739139-48739161 CTGGGCCGGCCCGCGGCGGCGGG - Exonic
1167376950 19:49117531-49117553 CTGAGCTGGCCCAGGGCTGTGGG + Intronic
1167437193 19:49486344-49486366 CAGCGCCGGCCCGGGGCTCCAGG - Intergenic
1167710685 19:51108602-51108624 CTGCGCCTGCGCGCGGCCGCAGG + Intergenic
1168063856 19:53908652-53908674 CTGCGCCCGCCCGCTGCTGTAGG + Intergenic
1168240842 19:55088128-55088150 TTTCCCTGGCTCGCGGCTGCTGG + Intergenic
1168297347 19:55383862-55383884 GGGCGCTGGCCCGCGGCGGCGGG + Exonic
1168414508 19:56159915-56159937 CAGCGCGGGCCCGGGGCTGCCGG - Exonic
925036391 2:690086-690108 CTCCTCTGCCCCGGGGCTGCCGG + Intergenic
926283113 2:11466170-11466192 CTGCGCATGCCCGCCGCTGCCGG + Intronic
932580511 2:72990136-72990158 CTGCGCTGCCCCGGGGCTGGCGG - Intronic
932599357 2:73113058-73113080 CCGGGCTGGTCTGCGGCTGCCGG - Intronic
932892478 2:75609036-75609058 CTGCGCTGCCCTGGGGCTCCTGG + Intergenic
933775568 2:85769399-85769421 CAGCACTGGCACACGGCTGCAGG - Intronic
933780142 2:85795585-85795607 CTGCCCTGGCGAGTGGCTGCAGG + Intergenic
933791754 2:85888845-85888867 CTGCCTCGGTCCGCGGCTGCAGG + Exonic
934561903 2:95317857-95317879 CGGCCCTGGCCCGAGGCTGCAGG + Intronic
935592038 2:104853327-104853349 CCGCGCTGGTCCTGGGCTGCAGG + Intergenic
935645336 2:105329678-105329700 CCGCTCCGGCCCGCGGCTCCTGG + Exonic
938293251 2:130161470-130161492 CTGCGCTGGCCCGCGGCTGCTGG - Intronic
938463300 2:131511495-131511517 CTGCGCTGGCCCGCGGCTGCTGG + Intergenic
943725172 2:191245485-191245507 CAAGGCTGTCCCGCGGCTGCCGG - Exonic
945955380 2:216081743-216081765 CTGCTCTGGCACCCCGCTGCAGG - Exonic
946162166 2:217841859-217841881 CTGCTCTGGCCCCCAGCTTCTGG + Intronic
946747571 2:222861215-222861237 CTGCGCGGGCCCGAGGCCGGAGG + Exonic
947765317 2:232633910-232633932 CTGCGCGGCCCCGGCGCTGCAGG + Exonic
948053613 2:234995765-234995787 GGGCTCTGTCCCGCGGCTGCTGG - Intronic
948598669 2:239096242-239096264 CTGCGATGGCCCCAAGCTGCAGG + Intronic
1168887006 20:1266794-1266816 CTGCGCTGCACCGCGGCAGGTGG + Intronic
1171452972 20:25248607-25248629 CTGCGCAGGGCCGCGGCCACGGG + Intronic
1172015426 20:31870255-31870277 CAGCGCCGGGCCGCGGCGGCCGG + Intronic
1172654427 20:36528296-36528318 CTGCAATGGCCCGGGCCTGCAGG + Exonic
1175179480 20:57135310-57135332 GTGTGCTGGCCCTGGGCTGCCGG - Intergenic
1178544178 21:33479659-33479681 CTCCGCGGGCCCGAGTCTGCAGG + Intronic
1181048433 22:20227522-20227544 CAGCGCTGTCCCGAGGCAGCAGG - Intergenic
1181650908 22:24258640-24258662 CTGGGCTCCCCCGCAGCTGCCGG + Intergenic
1182572243 22:31248210-31248232 CTGGGCTGGATCGAGGCTGCAGG - Intronic
1182620217 22:31614739-31614761 CTGGGCTGACCAGGGGCTGCAGG - Intronic
1182715400 22:32353566-32353588 CTGCGCTGCCCCCCTGGTGCTGG - Intergenic
1183091201 22:35523353-35523375 CGGCGCTGGCCCCAGGGTGCAGG - Intergenic
1183459629 22:37942014-37942036 CCGCTGTGGCCCGAGGCTGCAGG - Exonic
1183770424 22:39920493-39920515 CTGAGCTGCACCCCGGCTGCAGG - Intronic
1184858372 22:47158809-47158831 CTGCCCTGGCTGGTGGCTGCGGG - Intronic
1185055178 22:48575619-48575641 CCACGCTGGGCCGCCGCTGCCGG - Intronic
950316405 3:12004969-12004991 CTCTCCTGGCCTGCGGCTGCCGG - Intronic
952942571 3:38455092-38455114 CTCAGCTCGCCCGCGGCTGCGGG + Intronic
954304669 3:49719306-49719328 CTGCACTGGCCTAGGGCTGCAGG - Exonic
954862427 3:53702068-53702090 CTGCTCTGGCCCGAACCTGCAGG + Intronic
962763744 3:138542523-138542545 CTGCTCTGGCCAGTGGCTCCTGG + Intronic
963870317 3:150408760-150408782 CAGCTCCGGCCCGCGGCTCCCGG + Exonic
968591575 4:1462317-1462339 CTGAGCTGGCCCGAGGCTACCGG + Intergenic
969703981 4:8782256-8782278 CTGCTCTGTCCCGGGGCTGGGGG - Intergenic
976068351 4:81215092-81215114 CAGCGTGGGCCCGGGGCTGCCGG + Exonic
983352021 4:166602214-166602236 CTGCTCTGGCCCACGGCTCTGGG - Intergenic
984255009 4:177381054-177381076 CTGCTCTAGTCCACGGCTGCGGG + Intergenic
984954502 4:185031985-185032007 CTGTGTTGGCCCTCAGCTGCAGG - Intergenic
990471137 5:56116753-56116775 CTGCACTGGGCTGCAGCTGCAGG - Exonic
994948177 5:106423312-106423334 CTGCTCTGGCCAGTGGCTCCTGG - Intergenic
1001209009 5:169792948-169792970 CTGCACTTGCCTGCAGCTGCTGG - Intronic
1001382260 5:171312394-171312416 CGGCGCTGGCCCGCGGCCTTCGG - Intergenic
1001462047 5:171924693-171924715 CTGCTCTGGCCCACGGCTCCTGG - Intronic
1001759911 5:174198816-174198838 CTGCTCTGGCCCCCGGCTGCCGG - Intronic
1001824089 5:174732187-174732209 CTGAGATCGCCCGGGGCTGCGGG - Intergenic
1002004112 5:176217625-176217647 CTGCACTGTCCAGTGGCTGCAGG + Intergenic
1002222262 5:177693015-177693037 CTGCGCTGTCCAGTGGCTGCAGG - Intergenic
1015910171 6:138161840-138161862 CTCCGCTCGGCGGCGGCTGCGGG - Intergenic
1015965466 6:138692706-138692728 CTGCGCCGGCCCGAGGCGGCGGG - Intergenic
1018998523 6:168728239-168728261 GTGTGCTTGCCCGGGGCTGCTGG - Intergenic
1019340669 7:507435-507457 CTGCACTGGCCAGAGGGTGCTGG + Intronic
1019417944 7:935752-935774 CTGCTCTGCCCCGCGGGTGCCGG + Intronic
1019432444 7:1005541-1005563 CTGGGCTGTCCCTCGGCAGCGGG + Intronic
1019525555 7:1478937-1478959 CTGCTCTGGGCCTCGGGTGCCGG - Intronic
1022018501 7:26376430-26376452 CCGCGCGGGCCTGCGGCTCCCGG + Intergenic
1023870876 7:44262436-44262458 TTGCGCTGGCCCAGGGCTTCTGG - Intronic
1025087322 7:56034002-56034024 CGGCGCTGGCCCCCTGCAGCCGG - Exonic
1025089742 7:56052067-56052089 CTGCGCAGCCCCGAGGCGGCGGG - Intronic
1028641136 7:93043490-93043512 CGGCGCTGGGCTGCGGCAGCTGG - Intergenic
1030055892 7:105583328-105583350 CTGAGCAGCCCCGCCGCTGCCGG - Intronic
1030216036 7:107044741-107044763 CTGGCCCGGCCCGCGGCTCCCGG - Exonic
1035751698 8:2001393-2001415 CAGCGGTGGCCCGCGGGTGGTGG + Exonic
1037273746 8:17156547-17156569 CCGCGCCGGCTCGGGGCTGCGGG + Exonic
1037450798 8:19014008-19014030 CAGGGCGGGCGCGCGGCTGCGGG - Intronic
1037827902 8:22170206-22170228 CTGTGCTGGCCTGCGGGTCCAGG - Intronic
1037883843 8:22586047-22586069 CAGCCCTGGGCCGCAGCTGCTGG + Intronic
1037988501 8:23304379-23304401 CTGCCCAGGCCCGGGGCTGAAGG + Intronic
1040559926 8:48514828-48514850 CTTGGCTGGCCCGCGGGTCCAGG - Intergenic
1043479776 8:80641303-80641325 CTGCCCTGGCCTGCCACTGCAGG - Exonic
1044819285 8:96145020-96145042 CTGGGCTCGGCCGAGGCTGCGGG - Exonic
1048833325 8:138496866-138496888 CTGCCCTCGCCCGCCGCCGCCGG + Intergenic
1049796857 8:144500959-144500981 CGGCGCTCACCCGCGGCTGCCGG - Exonic
1050913837 9:11107218-11107240 CTGCGCTATGCCACGGCTGCTGG - Intergenic
1057314090 9:93958088-93958110 CAGGGCTGGCCTGGGGCTGCAGG - Intergenic
1057315943 9:93968594-93968616 CTGGGCTGGTCTGGGGCTGCAGG - Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1060400542 9:123346320-123346342 CTGCCCTGTCCACCGGCTGCTGG + Intergenic
1060474592 9:123977191-123977213 CTCTGCTGCACCGCGGCTGCCGG - Intergenic
1060476770 9:123992932-123992954 CTCTGCTGCACCGCGGCTGCCGG + Intergenic
1060522916 9:124304060-124304082 CTGCTCTGGGCAGCGGCTGTCGG + Intronic
1062014938 9:134286642-134286664 CCTCACTGGCCCGGGGCTGCAGG - Intergenic
1062231443 9:135484218-135484240 CTGCTCCAGCCCGGGGCTGCTGG - Intronic
1062266530 9:135688999-135689021 CTGCGCTGTCCTGGGCCTGCAGG - Intergenic
1062600927 9:137318299-137318321 ATGAGCTGGGCCCCGGCTGCCGG + Intronic
1062607299 9:137353957-137353979 CTGCGCTGGCACCGGGCTGGGGG + Intronic
1197018664 X:121659241-121659263 CAGGGCTGGCCAGCGGCTGGAGG - Intergenic
1200249901 X:154547242-154547264 CTGGGCTGTCCCTCGGCTCCTGG + Exonic