ID: 938294068

View in Genome Browser
Species Human (GRCh38)
Location 2:130166414-130166436
Sequence GTGTGGACCGTAGGCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938294068_938294076 20 Left 938294068 2:130166414-130166436 CCAGCACAGCCTACGGTCCACAC No data
Right 938294076 2:130166457-130166479 TCATGGTCCCCTCTGTGAACAGG No data
938294068_938294077 21 Left 938294068 2:130166414-130166436 CCAGCACAGCCTACGGTCCACAC No data
Right 938294077 2:130166458-130166480 CATGGTCCCCTCTGTGAACAGGG No data
938294068_938294078 22 Left 938294068 2:130166414-130166436 CCAGCACAGCCTACGGTCCACAC No data
Right 938294078 2:130166459-130166481 ATGGTCCCCTCTGTGAACAGGGG No data
938294068_938294072 -5 Left 938294068 2:130166414-130166436 CCAGCACAGCCTACGGTCCACAC No data
Right 938294072 2:130166432-130166454 CACACAGCCAAGAGCCATCTGGG No data
938294068_938294071 -6 Left 938294068 2:130166414-130166436 CCAGCACAGCCTACGGTCCACAC No data
Right 938294071 2:130166431-130166453 CCACACAGCCAAGAGCCATCTGG No data
938294068_938294081 28 Left 938294068 2:130166414-130166436 CCAGCACAGCCTACGGTCCACAC No data
Right 938294081 2:130166465-130166487 CCCTCTGTGAACAGGGGCAACGG No data
938294068_938294074 3 Left 938294068 2:130166414-130166436 CCAGCACAGCCTACGGTCCACAC No data
Right 938294074 2:130166440-130166462 CAAGAGCCATCTGGGCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938294068 Original CRISPR GTGTGGACCGTAGGCTGTGC TGG (reversed) Intronic
No off target data available for this crispr