ID: 938294069

View in Genome Browser
Species Human (GRCh38)
Location 2:130166423-130166445
Sequence CTCTTGGCTGTGTGGACCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938294069_938294077 12 Left 938294069 2:130166423-130166445 CCTACGGTCCACACAGCCAAGAG No data
Right 938294077 2:130166458-130166480 CATGGTCCCCTCTGTGAACAGGG No data
938294069_938294074 -6 Left 938294069 2:130166423-130166445 CCTACGGTCCACACAGCCAAGAG No data
Right 938294074 2:130166440-130166462 CAAGAGCCATCTGGGCATCATGG No data
938294069_938294081 19 Left 938294069 2:130166423-130166445 CCTACGGTCCACACAGCCAAGAG No data
Right 938294081 2:130166465-130166487 CCCTCTGTGAACAGGGGCAACGG No data
938294069_938294078 13 Left 938294069 2:130166423-130166445 CCTACGGTCCACACAGCCAAGAG No data
Right 938294078 2:130166459-130166481 ATGGTCCCCTCTGTGAACAGGGG No data
938294069_938294076 11 Left 938294069 2:130166423-130166445 CCTACGGTCCACACAGCCAAGAG No data
Right 938294076 2:130166457-130166479 TCATGGTCCCCTCTGTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938294069 Original CRISPR CTCTTGGCTGTGTGGACCGT AGG (reversed) Intronic
No off target data available for this crispr