ID: 938294070

View in Genome Browser
Species Human (GRCh38)
Location 2:130166431-130166453
Sequence CCAGATGGCTCTTGGCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938294070_938294081 11 Left 938294070 2:130166431-130166453 CCACACAGCCAAGAGCCATCTGG No data
Right 938294081 2:130166465-130166487 CCCTCTGTGAACAGGGGCAACGG No data
938294070_938294078 5 Left 938294070 2:130166431-130166453 CCACACAGCCAAGAGCCATCTGG No data
Right 938294078 2:130166459-130166481 ATGGTCCCCTCTGTGAACAGGGG No data
938294070_938294076 3 Left 938294070 2:130166431-130166453 CCACACAGCCAAGAGCCATCTGG No data
Right 938294076 2:130166457-130166479 TCATGGTCCCCTCTGTGAACAGG No data
938294070_938294077 4 Left 938294070 2:130166431-130166453 CCACACAGCCAAGAGCCATCTGG No data
Right 938294077 2:130166458-130166480 CATGGTCCCCTCTGTGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938294070 Original CRISPR CCAGATGGCTCTTGGCTGTG TGG (reversed) Intronic
No off target data available for this crispr