ID: 938294075

View in Genome Browser
Species Human (GRCh38)
Location 2:130166446-130166468
Sequence AGGGGACCATGATGCCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938294075_938294078 -10 Left 938294075 2:130166446-130166468 CCATCTGGGCATCATGGTCCCCT No data
Right 938294078 2:130166459-130166481 ATGGTCCCCTCTGTGAACAGGGG No data
938294075_938294083 20 Left 938294075 2:130166446-130166468 CCATCTGGGCATCATGGTCCCCT No data
Right 938294083 2:130166489-130166511 TCTTACCATTCCACCCTGCGAGG No data
938294075_938294081 -4 Left 938294075 2:130166446-130166468 CCATCTGGGCATCATGGTCCCCT No data
Right 938294081 2:130166465-130166487 CCCTCTGTGAACAGGGGCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938294075 Original CRISPR AGGGGACCATGATGCCCAGA TGG (reversed) Intronic
No off target data available for this crispr