ID: 938294076

View in Genome Browser
Species Human (GRCh38)
Location 2:130166457-130166479
Sequence TCATGGTCCCCTCTGTGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938294070_938294076 3 Left 938294070 2:130166431-130166453 CCACACAGCCAAGAGCCATCTGG No data
Right 938294076 2:130166457-130166479 TCATGGTCCCCTCTGTGAACAGG No data
938294068_938294076 20 Left 938294068 2:130166414-130166436 CCAGCACAGCCTACGGTCCACAC No data
Right 938294076 2:130166457-130166479 TCATGGTCCCCTCTGTGAACAGG No data
938294069_938294076 11 Left 938294069 2:130166423-130166445 CCTACGGTCCACACAGCCAAGAG No data
Right 938294076 2:130166457-130166479 TCATGGTCCCCTCTGTGAACAGG No data
938294073_938294076 -5 Left 938294073 2:130166439-130166461 CCAAGAGCCATCTGGGCATCATG No data
Right 938294076 2:130166457-130166479 TCATGGTCCCCTCTGTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938294076 Original CRISPR TCATGGTCCCCTCTGTGAAC AGG Intronic
No off target data available for this crispr