ID: 938294077

View in Genome Browser
Species Human (GRCh38)
Location 2:130166458-130166480
Sequence CATGGTCCCCTCTGTGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938294073_938294077 -4 Left 938294073 2:130166439-130166461 CCAAGAGCCATCTGGGCATCATG No data
Right 938294077 2:130166458-130166480 CATGGTCCCCTCTGTGAACAGGG No data
938294070_938294077 4 Left 938294070 2:130166431-130166453 CCACACAGCCAAGAGCCATCTGG No data
Right 938294077 2:130166458-130166480 CATGGTCCCCTCTGTGAACAGGG No data
938294069_938294077 12 Left 938294069 2:130166423-130166445 CCTACGGTCCACACAGCCAAGAG No data
Right 938294077 2:130166458-130166480 CATGGTCCCCTCTGTGAACAGGG No data
938294068_938294077 21 Left 938294068 2:130166414-130166436 CCAGCACAGCCTACGGTCCACAC No data
Right 938294077 2:130166458-130166480 CATGGTCCCCTCTGTGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938294077 Original CRISPR CATGGTCCCCTCTGTGAACA GGG Intronic
No off target data available for this crispr