ID: 938294078

View in Genome Browser
Species Human (GRCh38)
Location 2:130166459-130166481
Sequence ATGGTCCCCTCTGTGAACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938294068_938294078 22 Left 938294068 2:130166414-130166436 CCAGCACAGCCTACGGTCCACAC No data
Right 938294078 2:130166459-130166481 ATGGTCCCCTCTGTGAACAGGGG No data
938294070_938294078 5 Left 938294070 2:130166431-130166453 CCACACAGCCAAGAGCCATCTGG No data
Right 938294078 2:130166459-130166481 ATGGTCCCCTCTGTGAACAGGGG No data
938294073_938294078 -3 Left 938294073 2:130166439-130166461 CCAAGAGCCATCTGGGCATCATG No data
Right 938294078 2:130166459-130166481 ATGGTCCCCTCTGTGAACAGGGG No data
938294069_938294078 13 Left 938294069 2:130166423-130166445 CCTACGGTCCACACAGCCAAGAG No data
Right 938294078 2:130166459-130166481 ATGGTCCCCTCTGTGAACAGGGG No data
938294075_938294078 -10 Left 938294075 2:130166446-130166468 CCATCTGGGCATCATGGTCCCCT No data
Right 938294078 2:130166459-130166481 ATGGTCCCCTCTGTGAACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938294078 Original CRISPR ATGGTCCCCTCTGTGAACAG GGG Intronic
No off target data available for this crispr