ID: 938294081

View in Genome Browser
Species Human (GRCh38)
Location 2:130166465-130166487
Sequence CCCTCTGTGAACAGGGGCAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938294070_938294081 11 Left 938294070 2:130166431-130166453 CCACACAGCCAAGAGCCATCTGG No data
Right 938294081 2:130166465-130166487 CCCTCTGTGAACAGGGGCAACGG No data
938294068_938294081 28 Left 938294068 2:130166414-130166436 CCAGCACAGCCTACGGTCCACAC No data
Right 938294081 2:130166465-130166487 CCCTCTGTGAACAGGGGCAACGG No data
938294073_938294081 3 Left 938294073 2:130166439-130166461 CCAAGAGCCATCTGGGCATCATG No data
Right 938294081 2:130166465-130166487 CCCTCTGTGAACAGGGGCAACGG No data
938294069_938294081 19 Left 938294069 2:130166423-130166445 CCTACGGTCCACACAGCCAAGAG No data
Right 938294081 2:130166465-130166487 CCCTCTGTGAACAGGGGCAACGG No data
938294075_938294081 -4 Left 938294075 2:130166446-130166468 CCATCTGGGCATCATGGTCCCCT No data
Right 938294081 2:130166465-130166487 CCCTCTGTGAACAGGGGCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938294081 Original CRISPR CCCTCTGTGAACAGGGGCAA CGG Intronic
No off target data available for this crispr