ID: 938294083

View in Genome Browser
Species Human (GRCh38)
Location 2:130166489-130166511
Sequence TCTTACCATTCCACCCTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938294075_938294083 20 Left 938294075 2:130166446-130166468 CCATCTGGGCATCATGGTCCCCT No data
Right 938294083 2:130166489-130166511 TCTTACCATTCCACCCTGCGAGG No data
938294082_938294083 0 Left 938294082 2:130166466-130166488 CCTCTGTGAACAGGGGCAACGGT No data
Right 938294083 2:130166489-130166511 TCTTACCATTCCACCCTGCGAGG No data
938294073_938294083 27 Left 938294073 2:130166439-130166461 CCAAGAGCCATCTGGGCATCATG No data
Right 938294083 2:130166489-130166511 TCTTACCATTCCACCCTGCGAGG No data
938294079_938294083 2 Left 938294079 2:130166464-130166486 CCCCTCTGTGAACAGGGGCAACG No data
Right 938294083 2:130166489-130166511 TCTTACCATTCCACCCTGCGAGG No data
938294080_938294083 1 Left 938294080 2:130166465-130166487 CCCTCTGTGAACAGGGGCAACGG No data
Right 938294083 2:130166489-130166511 TCTTACCATTCCACCCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938294083 Original CRISPR TCTTACCATTCCACCCTGCG AGG Intronic
No off target data available for this crispr