ID: 938299582

View in Genome Browser
Species Human (GRCh38)
Location 2:130200652-130200674
Sequence ATGGCCAACAGGAAAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 2, 2: 3, 3: 53, 4: 509}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938299582 Original CRISPR ATGGCCAACAGGAAAGGGGA AGG Intergenic
901347638 1:8560481-8560503 ATGGCCTACTGGAAAGAAGATGG + Intronic
902530107 1:17085471-17085493 AAAGCTAACAGGATAGGGGACGG - Intronic
902749738 1:18499451-18499473 ATGGGGACCTGGAAAGGGGAAGG - Intergenic
902880796 1:19370596-19370618 ATGCCCACAAGGAAAGGAGAAGG + Intronic
903630065 1:24761739-24761761 ATTGCCATCAAGAAAGGTGATGG + Intronic
904015103 1:27413658-27413680 CTGGACAACAGGAAAATGGAAGG + Intronic
904526306 1:31136395-31136417 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
904738217 1:32651307-32651329 ATGGCCGACAAGGAAGGTGAGGG + Exonic
905314816 1:37075548-37075570 AGGGCCAAAATGAGAGGGGAAGG + Intergenic
905473912 1:38212559-38212581 ATGGCAACCCGGGAAGGGGATGG + Intergenic
905495673 1:38383968-38383990 CTGGTTTACAGGAAAGGGGATGG - Intergenic
905830193 1:41059500-41059522 ATGGGGAGCTGGAAAGGGGATGG - Intronic
907378793 1:54067545-54067567 AAGGAAAAGAGGAAAGGGGAAGG - Intronic
907596782 1:55727443-55727465 ATGGGCTACAGAAATGGGGAGGG + Intergenic
908896777 1:68909963-68909985 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
909094504 1:71270832-71270854 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
909501098 1:76336790-76336812 ATGGCCAAGGGCAAAGGGCAAGG + Intronic
909917405 1:81337113-81337135 ATGGAGAGCTGGAAAGGGGATGG - Intronic
910488899 1:87746347-87746369 ATGGGGAACTGGAAAGGAGATGG - Intergenic
910630009 1:89344631-89344653 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
910643193 1:89486746-89486768 AAGGACAAAAGGAAAGGAGAGGG - Intergenic
911335439 1:96575177-96575199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
912041469 1:105396691-105396713 ATGGGGAATTGGAAAGGGGATGG + Intergenic
912572991 1:110638103-110638125 ATGCCGAAGAGGAGAGGGGAGGG - Intergenic
912861423 1:113217179-113217201 AGAGCCAAGAGGGAAGGGGAAGG - Intergenic
913203731 1:116517040-116517062 AGGGCCACGGGGAAAGGGGATGG - Intronic
913338320 1:117731903-117731925 AGGGCCAAGATGAGAGGGGATGG + Intergenic
913461579 1:119091741-119091763 ACAGCCAACAGGAAGGGGGAAGG + Intronic
915265759 1:154716301-154716323 ATGGCTGACAGAAATGGGGATGG - Intronic
915352036 1:155232874-155232896 ATGGCCAGCCGGGGAGGGGACGG + Intergenic
917099532 1:171431447-171431469 ATGGGCAGCTAGAAAGGGGATGG + Intergenic
917211022 1:172632100-172632122 ATGGGGAACTGGAAAGGGGATGG - Intergenic
917502848 1:175601306-175601328 ATGGCCAACCTCAAAGGCGAGGG - Intronic
917589195 1:176459637-176459659 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
917656026 1:177126530-177126552 ATGGAAAACAGGAAAAAGGAAGG + Intronic
917962439 1:180155356-180155378 AGGGCCAAGAGGAAAAGGCAAGG - Intronic
918528048 1:185486536-185486558 GGGGCCAACAGGAAAAGGAAGGG + Intergenic
920054476 1:203182281-203182303 GGGGCCAACAGGAAAGGGGGAGG + Intronic
920108673 1:203572139-203572161 CTGGCCCACAGGAATGGAGAAGG - Intergenic
920955988 1:210620473-210620495 ATGGGCTACAGGAAAGGAAAAGG - Intronic
921520928 1:216153073-216153095 ATGGGAAACTGGAAAGGGGATGG - Intronic
921604204 1:217136677-217136699 CTGGCCAAAAGGAAAGGGGAAGG - Intronic
921883362 1:220278516-220278538 GTAGGAAACAGGAAAGGGGAAGG - Intergenic
922334298 1:224606376-224606398 ATGGGGAGCTGGAAAGGGGATGG + Intronic
923270792 1:232353421-232353443 ATGGCCACAAGCAAACGGGAAGG + Intergenic
923975481 1:239257319-239257341 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1063215182 10:3918453-3918475 ATGGCCAACAGGTATGTGAAAGG - Intergenic
1063572617 10:7230107-7230129 ATGGTCAGCAGGATATGGGAAGG - Intronic
1063835282 10:10005195-10005217 GTGCCCAACAGGGAAGGGCAGGG - Intergenic
1064600178 10:16985398-16985420 ATGGGGAACTGGAAAGGGGATGG - Intronic
1065454402 10:25891951-25891973 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1066053386 10:31658593-31658615 CTGCCCAACAGGAAAGGGGTTGG + Intergenic
1066305115 10:34133016-34133038 ATGGGAAGCTGGAAAGGGGATGG - Intronic
1067146294 10:43695986-43696008 CCGGCCATGAGGAAAGGGGATGG - Intergenic
1067174478 10:43933941-43933963 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1067897627 10:50201161-50201183 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1068403797 10:56564133-56564155 CTGGCCAAAAAGAAAGGGAAAGG + Intergenic
1068408711 10:56626640-56626662 ATGGCCTAAAGGACAGGGGATGG - Intergenic
1068497902 10:57808387-57808409 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1068907063 10:62338518-62338540 ATGGGGAACTGGAAAGGGGTGGG - Intergenic
1069861880 10:71476562-71476584 TTGGCCAAGAGGACAGAGGATGG + Intronic
1071385139 10:85112264-85112286 ATGGCCATTAGGCAAGGGGGTGG + Intergenic
1072141270 10:92591283-92591305 AAAGCGGACAGGAAAGGGGAAGG - Intergenic
1072487189 10:95866799-95866821 ATGGCAAACAGGAGAGAGAAAGG - Exonic
1073249109 10:102111044-102111066 ATGGCCAAGGGAAAAGGGGCTGG - Intronic
1073735076 10:106336273-106336295 ATGGTGAGCTGGAAAGGGGATGG - Intergenic
1073987928 10:109230313-109230335 ATGGGAATCAGGAAAAGGGAAGG - Intergenic
1074357773 10:112801160-112801182 ATGGCCAGCAGGAGGTGGGAGGG + Intronic
1075737456 10:124672742-124672764 AGGGCTGACAGGAAAGGGTAAGG + Intronic
1077591181 11:3492098-3492120 CTGACCCACAGGAAAGGAGAGGG + Intergenic
1078156445 11:8803993-8804015 CTGGCCAGCAGGAAAGGGGCAGG + Intronic
1078391694 11:10940488-10940510 ATGGGAAAGTGGAAAGGGGAGGG - Intergenic
1078708595 11:13768615-13768637 AAGGCCATCAGGCTAGGGGAAGG - Intergenic
1081595692 11:44457955-44457977 GTGGCCATTAGGAAAGGAGAGGG - Intergenic
1081863844 11:46348816-46348838 TTGGCCACCAGGGAAGGGCAAGG - Intronic
1082774190 11:57233422-57233444 ATAGGCATCAGGAAAGGGAAAGG - Intergenic
1083118548 11:60489369-60489391 AAGGCCAACAGGAGAAGGAAGGG + Intergenic
1083827142 11:65210272-65210294 CTGCCCAACAGGATGGGGGAGGG - Intronic
1084313744 11:68331827-68331849 GGGGCCAACAGGAATGGGGGTGG + Intronic
1084606798 11:70177085-70177107 AGAGACAACAGGAAATGGGAGGG - Intronic
1085169887 11:74440696-74440718 ATGGCCAGCAGGAGAGGTGGTGG - Intergenic
1085947009 11:81284459-81284481 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
1085993816 11:81886221-81886243 ATGACCAAAAGGACAGTGGAAGG + Intergenic
1087062423 11:93993255-93993277 ATGGCGAACAGGGAAAAGGAGGG - Intergenic
1087208185 11:95418602-95418624 ATGGCTATCAGGACAGCGGATGG - Intergenic
1087346185 11:96973769-96973791 ATTGGGAAGAGGAAAGGGGAAGG + Intergenic
1087439237 11:98161629-98161651 AGGGGAAACCGGAAAGGGGATGG - Intergenic
1087698784 11:101412399-101412421 ATGGCGAGCTGGAAAGGGGATGG - Intergenic
1088450618 11:109977747-109977769 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1088451909 11:109990521-109990543 ATGTCTAACAGGAGAGGAGAGGG - Intergenic
1088777594 11:113100548-113100570 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1088999363 11:115038198-115038220 CTGGGCAACTGGAAAGAGGAAGG - Intergenic
1089725018 11:120469289-120469311 ATGGCCAACAGAAAGGGAGAAGG + Exonic
1089887688 11:121844109-121844131 TTGGCCAGCAGGAAGGAGGAAGG + Intergenic
1090249041 11:125238238-125238260 ATGGCTAACACCAAAGGGGAGGG + Intronic
1090678912 11:129031994-129032016 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1090846013 11:130530478-130530500 TTGGCCTCCAAGAAAGGGGATGG + Intergenic
1091010706 11:131998045-131998067 AAGGCCTCCAGGAAAGAGGAGGG - Intronic
1091223706 11:133945692-133945714 AGAGCCAAGAGGAAAGGGGTGGG + Intronic
1091552657 12:1548585-1548607 ATGGCAAGCAGGAGAGGGGGTGG - Intronic
1091678598 12:2510082-2510104 ATGGCCAACATGAAAAATGAGGG - Intronic
1092149034 12:6234270-6234292 ATGTTCAGCAGGAAGGGGGAAGG + Intronic
1092927314 12:13283053-13283075 GTGAAGAACAGGAAAGGGGAGGG + Intergenic
1093749237 12:22779559-22779581 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1093769100 12:22998980-22999002 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1093937760 12:25019410-25019432 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1094031595 12:26017961-26017983 ATAGCCAATGGGAAAGGGAAAGG - Intronic
1094523699 12:31218390-31218412 AAGGACAAGGGGAAAGGGGAAGG + Intergenic
1094583105 12:31752421-31752443 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1095862182 12:46929870-46929892 ATGGCGAACAGTAAAGAAGATGG - Intergenic
1095974975 12:47933984-47934006 ATCGCCAACAGAAAAGGGAGAGG - Intronic
1097674705 12:62587061-62587083 ATGCACACCAGGAATGGGGAGGG + Intronic
1098484525 12:71005270-71005292 GTGGTTAACAGGAAAGGGCATGG - Intergenic
1098757671 12:74386958-74386980 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1098758334 12:74391671-74391693 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1099509635 12:83517994-83518016 ATGGGAAATCGGAAAGGGGATGG - Intergenic
1099774981 12:87114282-87114304 ATGGCAGAAAGCAAAGGGGAAGG + Intergenic
1100978504 12:100146035-100146057 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1101469608 12:104984252-104984274 ATGGGGAATAGGAAAGGGGATGG + Intergenic
1101703916 12:107202322-107202344 ATGGCATAAAGGAAGGGGGAAGG + Intergenic
1102426631 12:112848957-112848979 ATATCAAACAGGAAATGGGAAGG + Intronic
1103211269 12:119168289-119168311 ATTGCCAAATGGAAAGGGGTTGG + Intergenic
1103344723 12:120241638-120241660 TGGGCCAGGAGGAAAGGGGAGGG + Intronic
1103512334 12:121483964-121483986 TTGGCCAATGGGCAAGGGGAGGG + Intronic
1104550963 12:129756950-129756972 AAGGCTAACAGGAAGAGGGAGGG - Intronic
1105000122 12:132685585-132685607 ATGGCCTCCAGGCAGGGGGAAGG - Intronic
1105014118 12:132775899-132775921 ATGGACTACAGCAAATGGGAGGG - Intronic
1105308178 13:19183531-19183553 ATGGCCACCAGGAAAGGGGAAGG + Intronic
1107090280 13:36472118-36472140 ATGGAAAACAAGAAAAGGGAGGG - Intergenic
1107294389 13:38894320-38894342 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1108158984 13:47618500-47618522 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
1108443209 13:50477527-50477549 ATGGAAATGAGGAAAGGGGAAGG + Intronic
1108799810 13:54081728-54081750 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1108809208 13:54200646-54200668 ATGGCTAAAAGGAAAGAGGCAGG - Intergenic
1109209242 13:59515479-59515501 TTGGACAAAAGAAAAGGGGATGG + Intergenic
1109300723 13:60587355-60587377 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
1109682878 13:65775529-65775551 ATGGTGGACAGGAAAGGAGATGG + Intergenic
1110072254 13:71191734-71191756 ATAGGCAACTGGAAAGGGGATGG + Intergenic
1111428535 13:88122188-88122210 ATGGCCAACATGATAGTGAATGG - Intergenic
1111451818 13:88428810-88428832 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1112171493 13:96977180-96977202 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1112259765 13:97867666-97867688 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1113055102 13:106259475-106259497 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1113126158 13:106981770-106981792 AGGGTCAACAGGAAAGGAAAGGG - Intergenic
1113266065 13:108619643-108619665 CTGGCCAAGAAGAAAGGGGAAGG + Intronic
1114390857 14:22307040-22307062 AAGTCCAGCAGGAAAGGGGATGG - Intergenic
1114473696 14:22980603-22980625 CTAGCCAACAGGACTGGGGAGGG + Intronic
1114547660 14:23514241-23514263 ATGCCTAAGAGGGAAGGGGAAGG - Intergenic
1114713705 14:24803786-24803808 ATGAGCGGCAGGAAAGGGGAAGG - Intergenic
1115899563 14:38129629-38129651 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1116429669 14:44831233-44831255 ATGGCCAATATCAAAGGGGCAGG - Intergenic
1116918435 14:50548052-50548074 ATGGCCTAAAGAACAGGGGATGG + Intronic
1117002988 14:51390597-51390619 ATGACCAAAAGAAAGGGGGATGG - Intergenic
1117943997 14:60998483-60998505 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1118062188 14:62151632-62151654 ATGGAAACCAGGAAATGGGAAGG - Intergenic
1118119832 14:62828492-62828514 ATGGCAGAAAGGGAAGGGGAAGG + Intronic
1120218376 14:81704993-81705015 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1120806129 14:88752897-88752919 ATGGCGAACTGGAGAGGGGATGG - Intronic
1121040410 14:90741597-90741619 ATTGAAAACAGAAAAGGGGATGG - Intronic
1122234036 14:100322176-100322198 AATGCCAGCAGGATAGGGGAGGG - Intergenic
1122632110 14:103111852-103111874 ATGGCCACCAGGTCAGGGGTGGG - Intergenic
1123065125 14:105615033-105615055 TTGGCCAACAGGACAGGTGTGGG - Intergenic
1123068118 14:105628274-105628296 CAGGCAAACAGGAGAGGGGAGGG - Intergenic
1123069326 14:105634467-105634489 TTGGCCAACAGGACAGGTGTGGG - Intergenic
1123088426 14:105730256-105730278 TTGGCCAACAGGACAGGTGTGGG - Intergenic
1123094370 14:105759627-105759649 TTGGCCAACAGGACAGGTGTGGG - Intergenic
1123124176 14:105933320-105933342 GTGGCCAGCAGGAAACAGGAAGG - Intergenic
1123214916 14:106799447-106799469 ATGGCCAGCAGGACATGGAAAGG + Intergenic
1125221343 15:37339504-37339526 AAGGACAACAGGAAAGTGAAGGG - Intergenic
1126789841 15:52211090-52211112 ATGGCCAACAGCAAGTTGGAAGG + Intronic
1127385044 15:58460364-58460386 ATGTGCAAAAGGAAAGGTGAAGG + Intronic
1127735153 15:61832491-61832513 GTGGCCACCAGGGAAGGGGTAGG - Intergenic
1127915236 15:63450013-63450035 TTTGCCAACAGGACAGGGGCAGG - Intergenic
1129198503 15:73984878-73984900 GTGGCCAACAGGGTTGGGGAAGG + Intronic
1129219339 15:74122354-74122376 ATTGCCTACAGGCAAGGAGAGGG + Intronic
1130558721 15:84942690-84942712 ATGGCCCACAGGAAAGAGTAAGG - Intronic
1131453364 15:92564337-92564359 AGAGTCAACAGGAAAGTGGAAGG + Intergenic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1131709515 15:95037817-95037839 ATGGGGAACTGGAAAGGGGATGG - Intergenic
1131736557 15:95338815-95338837 ATGGCCAACAGGGCAGAGGTGGG + Intergenic
1132124520 15:99210972-99210994 TTTTCCAAAAGGAAAGGGGATGG - Intronic
1132621940 16:871883-871905 ATGAACAGCAGGAGAGGGGAGGG + Intronic
1132714476 16:1283948-1283970 ATGGCCTGCAGGAGTGGGGAAGG + Intergenic
1132731332 16:1363699-1363721 ATGGCCACCAAGACAGGTGAGGG + Exonic
1132779041 16:1612905-1612927 AGGGCCAACAAGCAGGGGGATGG - Intronic
1132856454 16:2047284-2047306 AGGGAAAACAGGAAAGGGCATGG - Intronic
1133477748 16:6139785-6139807 ATGGGGAACAGGACAGGAGAAGG - Intronic
1133493901 16:6297878-6297900 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1133808772 16:9145267-9145289 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1134596277 16:15498565-15498587 AGGGGCAAAAGGAAATGGGAAGG + Intronic
1134873680 16:17676191-17676213 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1134903459 16:17959358-17959380 CTGGCCCACATGCAAGGGGAGGG - Intergenic
1135344703 16:21679217-21679239 ATGCCCTAGAGGAGAGGGGAAGG + Intronic
1135478180 16:22796556-22796578 ATGGTCACCAGGGAAGGGAAGGG - Intergenic
1135582707 16:23641678-23641700 ATGGCCAAAGGGACAGGGGTTGG - Intronic
1135625325 16:23989957-23989979 ATGCCCAAGAGGACAAGGGAAGG - Intronic
1135784229 16:25334080-25334102 AAGGGTAACAGAAAAGGGGAGGG - Intergenic
1136045082 16:27609060-27609082 CTGGGCAACAAGAAAAGGGAAGG - Intronic
1136127156 16:28192458-28192480 AAGGCCAACTAGAAATGGGAAGG - Intronic
1137000423 16:35225114-35225136 GTGGGCAACAAGCAAGGGGATGG - Intergenic
1137346431 16:47666220-47666242 AGGTGCAGCAGGAAAGGGGAAGG - Intronic
1138217705 16:55219186-55219208 ATGCTCAGCAGGTAAGGGGAAGG - Intergenic
1138345061 16:56315663-56315685 CTGACCACCAGGAAAGGGGTGGG - Intronic
1140461749 16:75145729-75145751 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1140832518 16:78765033-78765055 CTGCCCAACAGGACAGTGGAAGG + Intronic
1142285422 16:89169662-89169684 AGGTCCACCAGGAAAGGGAAGGG + Intergenic
1142292555 16:89199682-89199704 CTGGGCAGCAGGAAAAGGGAAGG + Intronic
1142638704 17:1272523-1272545 CTTGCCAACAGGAGAGGGAAGGG + Intergenic
1143007862 17:3848497-3848519 ATCGCGAACAGGAAAGGGGATGG - Intergenic
1143894187 17:10123777-10123799 AAGGCCCACAGGTAAGAGGAGGG + Intronic
1144432753 17:15210125-15210147 ATGGGCAAAAGAAAAAGGGAGGG + Intergenic
1145790860 17:27625736-27625758 ACGGCCAACTGTGAAGGGGATGG + Exonic
1146573092 17:33969519-33969541 CTGGGGAACAAGAAAGGGGAAGG + Intronic
1146785493 17:35717236-35717258 ATTGCCAAGAGGAATGTGGAAGG + Exonic
1147261290 17:39210908-39210930 TTGGCCACCAGGAAATGGGGTGG - Exonic
1147439018 17:40436221-40436243 AGGGCCTCCAGGAAAGGTGAGGG - Intergenic
1147439323 17:40437804-40437826 AGGGCAATCAGGAAAGGGGCTGG + Intergenic
1148996131 17:51711619-51711641 ATGGTCCCCAGAAAAGGGGAAGG + Intronic
1149329700 17:55568082-55568104 TTTGCCAGCTGGAAAGGGGAAGG + Intergenic
1149637751 17:58184306-58184328 AGGGGAAGCAGGAAAGGGGAAGG - Intergenic
1150859948 17:68790936-68790958 ATGAGAAACTGGAAAGGGGAAGG + Intergenic
1151068251 17:71177518-71177540 ATCTCCACCCGGAAAGGGGAAGG + Intergenic
1151506347 17:74530160-74530182 AGGGACAACAGGAAAGAGCATGG - Intronic
1151939287 17:77282537-77282559 ATGGCCCAAAGGCAGGGGGATGG - Intronic
1151990650 17:77571905-77571927 ATCGCCTCCAGGAAGGGGGAGGG - Intergenic
1152029979 17:77836217-77836239 ATGTCCAGCAGGAACAGGGAGGG + Intergenic
1153369192 18:4294832-4294854 ATGGGAAACTGGACAGGGGATGG + Intronic
1153681457 18:7504823-7504845 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1153851741 18:9101836-9101858 ATGGGCAAAAGGAAGGGGGTGGG + Intergenic
1154180402 18:12133616-12133638 ATGGTCAACATCAAAGGGAAAGG - Intergenic
1154505899 18:15040574-15040596 ATGGAGAACAGGAATGGGAATGG + Intergenic
1157259557 18:46166515-46166537 ATGGCCCACTGGAGAGGGCATGG - Intergenic
1157508429 18:48249360-48249382 ATGGCCAACATTAAGGGGAATGG + Intronic
1158226299 18:55205098-55205120 CTGGCCAGCAGAAAAGAGGAGGG - Intergenic
1158340490 18:56460766-56460788 CTGCCCACAAGGAAAGGGGAAGG - Intergenic
1158597877 18:58832265-58832287 CTGCCCAGCAGGAAAGGGGGAGG + Intergenic
1158929830 18:62313252-62313274 ATGGCTTACACGAAAGTGGAAGG + Intergenic
1158981595 18:62767208-62767230 TTTTCCAACAGGAATGGGGAAGG + Intronic
1159344572 18:67183582-67183604 AGGGACAAAAGGAGAGGGGAAGG + Intergenic
1159726578 18:71967858-71967880 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1160589621 18:79936036-79936058 ATGGCCAGCAGGAAGGAGGCTGG + Intronic
1160714783 19:571297-571319 AGGGCTAACTGGAAAGGGGCAGG - Intronic
1160874026 19:1288956-1288978 AGGTCCAACAGGACAGGTGAGGG - Intronic
1161102918 19:2430213-2430235 AAGGCCAACAGGGCAGGGGAGGG - Exonic
1161506821 19:4648574-4648596 AAGGCCAACAGGAAGAGGGATGG - Intronic
1161705082 19:5816274-5816296 AGGGGCCAAAGGAAAGGGGATGG - Intergenic
1162245117 19:9393482-9393504 GTTACAAACAGGAAAGGGGAAGG + Intergenic
1162790100 19:13058257-13058279 AGGGCCTACAGGAGAGGTGAGGG - Intronic
1162991290 19:14304021-14304043 ATGGGAAACAGGGAAGGGGGAGG + Intergenic
1163404297 19:17112839-17112861 ATGGCCAACAGCCAAGGGCTGGG - Intronic
1163632842 19:18425942-18425964 ATGGCCTCCAGGACAGGGGCCGG + Intronic
1163662580 19:18587657-18587679 ATGGACAAAAAGAAAGGGGAGGG + Intronic
1164038528 19:21474408-21474430 ATGGCCATTAGGAATGGGGCGGG - Intronic
1164244267 19:23416732-23416754 ATGGCCATTAGGAATGGGGCAGG + Intergenic
1164399834 19:27894940-27894962 ATGACCAACAGGAAAGAGCTGGG + Intergenic
1164481442 19:28614072-28614094 ACGGGCAATAGGAAAAGGGATGG - Intergenic
1164912869 19:32026649-32026671 ATGGGCAACAGGAAAGAGCAAGG - Intergenic
1166342588 19:42147835-42147857 AAGAGCAACAGGAAAGGGCATGG + Intronic
1168332578 19:55578857-55578879 AGGGCGAACAGGAAGGGGAAGGG - Exonic
1202645244 1_KI270706v1_random:133234-133256 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
925836520 2:7951996-7952018 ATGGGCAACAGGAAGGAGGCTGG - Intergenic
925874670 2:8301677-8301699 TTTGCCAACAGGAAAGATGAGGG + Intergenic
926060137 2:9800072-9800094 CTGGTCAACATGGAAGGGGAGGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927083979 2:19656326-19656348 AGGGCCAACAAGAAAAAGGAAGG + Intergenic
927519435 2:23690108-23690130 ATGGCCAGGAGGAGAGGGGGAGG - Intronic
927938541 2:27089209-27089231 ATGGTCAACAGCAAAGGGACAGG - Intronic
927981306 2:27376831-27376853 CTGGCCAAGAGAAAAGGGGTAGG - Exonic
928664492 2:33537119-33537141 ATGGGGAGCTGGAAAGGGGATGG + Intronic
928860753 2:35854719-35854741 ATGCCCAACAGCAAAGGAGATGG - Intergenic
928869662 2:35961502-35961524 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
929385709 2:41403722-41403744 AGGGAGAAAAGGAAAGGGGAAGG + Intergenic
929654587 2:43717659-43717681 GTGGCCAAGAGGCAAGGGCAAGG + Intronic
930416784 2:51099040-51099062 ATGGCCATCAGGAGAGGGTTGGG - Intergenic
930533201 2:52615461-52615483 ATGGGAAGCAGGAAAGGGGATGG - Intergenic
932481030 2:72039441-72039463 ATGGCCAACAGGACATAGGGGGG + Intergenic
933425949 2:82112540-82112562 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
934507649 2:94906820-94906842 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
934791760 2:97068090-97068112 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
935269614 2:101422676-101422698 ATGGCCATCAGGGAAGGGATAGG + Intronic
936928382 2:117761350-117761372 TTGGCCAAAAGGAAGGTGGAAGG - Intergenic
937729603 2:125212560-125212582 TTGGGCAACAGGATAGGGGAGGG - Intergenic
937939162 2:127271811-127271833 GTGGCCAACAGGTAAGAGTATGG - Intronic
938170955 2:129076291-129076313 ATGCCTAGCTGGAAAGGGGAAGG - Intergenic
938178762 2:129161213-129161235 ATGGCAGAGAGGAAAGGGAAGGG - Intergenic
938299582 2:130200652-130200674 ATGGCCAACAGGAAAGGGGAAGG + Intergenic
938457128 2:131473834-131473856 ATGGACAACAGGAAAGGGGAAGG - Intronic
938757900 2:134397530-134397552 ATGGCAAACAGGACACAGGAAGG - Intronic
939500266 2:142975334-142975356 ATGAGGAACTGGAAAGGGGATGG - Intronic
940658698 2:156520057-156520079 ATGGGGAGCTGGAAAGGGGATGG + Intronic
944058688 2:195548699-195548721 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
944139011 2:196434564-196434586 ATGGCAAACAGGTAAGGCGCTGG - Intronic
944293363 2:198033692-198033714 GTTTCCAACAGAAAAGGGGATGG - Intronic
945047979 2:205798692-205798714 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
945471147 2:210229006-210229028 AAGGGAAACTGGAAAGGGGATGG + Intergenic
946609397 2:221441440-221441462 ATGGGGAGCTGGAAAGGGGAAGG - Intronic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947544794 2:231003061-231003083 CTGGACAAGAGGAAATGGGAGGG + Intronic
947875024 2:233462146-233462168 ATGACCCACAGCAAATGGGAGGG - Intronic
948200196 2:236124217-236124239 GTGGCCACCAGGAAGAGGGAGGG - Exonic
1169876187 20:10299460-10299482 ATGACCAACAGGAAGTGTGAAGG + Intronic
1171211566 20:23321011-23321033 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1171465316 20:25323872-25323894 AAGGACAGCAGGAAAGGGGATGG + Intronic
1171895207 20:30752154-30752176 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1172396202 20:34607511-34607533 ATGGAGAGCTGGAAAGGGGATGG - Intronic
1172519298 20:35556875-35556897 AGGCTCAACAGGAAAGGGGAAGG + Intronic
1174188540 20:48723668-48723690 ATGGCCCGCAGGAAAAGCGATGG - Intronic
1174342437 20:49906280-49906302 ATGGTCAGCAGCGAAGGGGATGG + Exonic
1176606641 21:8839508-8839530 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1176791963 21:13328452-13328474 ATGGTGAACAGGAATGGGAATGG - Intergenic
1176981525 21:15386790-15386812 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1177991355 21:28039455-28039477 ATGGAGAACAGGAATGGGAATGG - Intergenic
1178087048 21:29122515-29122537 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1178265872 21:31142204-31142226 AGGGCCAACAGCTCAGGGGACGG - Intronic
1178283285 21:31303413-31303435 AAGGCCAACAGGATGCGGGAAGG + Intronic
1178437101 21:32569621-32569643 CTGTCCAACAGAAAAGAGGAAGG - Intergenic
1178804214 21:35824955-35824977 CTGACCAATAGAAAAGGGGAGGG + Intronic
1178846897 21:36181636-36181658 CTGTCCCACAGGAAAAGGGAAGG + Intronic
1179169554 21:38962410-38962432 ATGCCCAGCAGGAAGTGGGAAGG - Intergenic
1179893597 21:44349898-44349920 ATGGCCAACGGGAGCGGGAAAGG - Intergenic
1180356715 22:11849210-11849232 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1180381546 22:12143121-12143143 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1180566231 22:16667913-16667935 ATGGTCAACATCAAAGGGAAAGG + Intergenic
1180703504 22:17794614-17794636 AGGGCCAGAAGGAAAGGGGGTGG - Intronic
1181309837 22:21938618-21938640 ATGGCCGACAGGAAATGGCAAGG + Intronic
1181480701 22:23197589-23197611 GTGGACAACAGGGAAGGTGAGGG + Intronic
1181807839 22:25385719-25385741 GGGGCCAACAGGAATGGGGGTGG - Intronic
1182155105 22:28064092-28064114 ATGGCAGACAGGGTAGGGGATGG + Intronic
1183802392 22:40177843-40177865 TTGTCAATCAGGAAAGGGGAGGG - Intronic
1185120950 22:48969703-48969725 ATGGCCTAAAGGACAGGAGACGG - Intergenic
1185207969 22:49551094-49551116 TTGGCCAACAGCAAAGAGGAAGG - Intronic
1185310257 22:50150371-50150393 ATGGGCAAGAGGCAAGGGGCAGG + Intronic
949689667 3:6621295-6621317 ATGGGGAATTGGAAAGGGGATGG - Intergenic
950204440 3:11067920-11067942 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG + Intergenic
951004353 3:17599455-17599477 ATGGGGAGCTGGAAAGGGGATGG - Intronic
952039212 3:29241318-29241340 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
952109775 3:30109118-30109140 ATGGGGAACTGCAAAGGGGATGG - Intergenic
953013582 3:39051947-39051969 TTGGCCAAAGGGAAAGGGGCAGG + Intergenic
953183933 3:40620996-40621018 ATGCCCACCAGCAATGGGGATGG + Intergenic
953981478 3:47415290-47415312 ATGGCCAAGAGGAAAGCACATGG + Intronic
954584892 3:51724747-51724769 ATGGCCAACAGGATATGAAAAGG - Intergenic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
956900378 3:73709218-73709240 CAGGTCAACAGGAAAGTGGATGG + Intergenic
957586530 3:82139413-82139435 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
957831186 3:85522187-85522209 AAGGCGAACAGGGAAGGGGACGG - Intronic
957984964 3:87562462-87562484 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
958023953 3:88028435-88028457 ATGGAGAACTGGAAAGGGGATGG - Intergenic
958439028 3:94133222-94133244 ATGGCAAAAAGGAAAGGAGAGGG + Intergenic
959065213 3:101648982-101649004 ATGGGGAGCTGGAAAGGGGATGG + Exonic
959164387 3:102758731-102758753 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
959486634 3:106934500-106934522 GTGGGGAACTGGAAAGGGGATGG - Intergenic
960508970 3:118525615-118525637 ATGGGGAACTGGAAAAGGGATGG + Intergenic
960586352 3:119323921-119323943 ATTCCCAGCAGGAAAGGGGAAGG - Intronic
962444844 3:135455134-135455156 AAGGCCAACATGACAGGCGAAGG - Intergenic
962776648 3:138667325-138667347 ATGGCCAACAGGAACCTGCATGG - Intronic
962938801 3:140106618-140106640 ATGGCCCACAGGAAAATGGGAGG + Intronic
963005415 3:140722529-140722551 TTGGCCCACATGTAAGGGGAGGG - Intergenic
963033178 3:140999543-140999565 ATGGCCAGCAGGCAAGAAGAGGG - Intergenic
963917599 3:150873360-150873382 CTGCCCACCTGGAAAGGGGAAGG + Exonic
964098130 3:152957253-152957275 GTGGCAGAAAGGAAAGGGGAGGG + Intergenic
964739857 3:159953994-159954016 TGAGCCAACAGAAAAGGGGATGG + Intergenic
965085319 3:164088750-164088772 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
965300827 3:167002553-167002575 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
965710519 3:171552300-171552322 ATGACCACATGGAAAGGGGATGG - Intergenic
965803975 3:172523547-172523569 CTGGGCAGTAGGAAAGGGGAGGG - Intergenic
967286702 3:187878379-187878401 ATGCCCTACAGGATAGGAGAGGG - Intergenic
967448767 3:189598289-189598311 AGGGACAGCAGGAGAGGGGAGGG + Intergenic
967713072 3:192731606-192731628 ATGTCAAAGAGGAAAGTGGACGG + Intronic
968513566 4:1005666-1005688 ATGGCCGCCAGGGAAGGAGACGG - Intergenic
969132913 4:5004717-5004739 ATGGCCAGCAGGGGAGGGGTGGG + Intergenic
970390717 4:15609040-15609062 ATGGACAACAGAAAAGGTGAGGG + Intronic
971427330 4:26529510-26529532 AAGGGGAGCAGGAAAGGGGATGG + Intergenic
971742677 4:30540152-30540174 ATGGGGATCTGGAAAGGGGATGG + Intergenic
971796823 4:31238931-31238953 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
971840239 4:31842198-31842220 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
972759339 4:42087803-42087825 ATGGCAAGTGGGAAAGGGGAAGG - Exonic
973371471 4:49251649-49251671 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
973389537 4:49543662-49543684 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
975707065 4:77121887-77121909 ATGGGGAATTGGAAAGGGGATGG + Intergenic
976961754 4:90984987-90985009 CTGGCCAGCAGGAAAGGCGAAGG + Intronic
977441200 4:97070342-97070364 ATGGGCAGCTGGAAGGGGGATGG - Intergenic
979036473 4:115726021-115726043 GTGGCCACAAGGAAAGGAGAGGG + Intergenic
979728403 4:123992247-123992269 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
980097039 4:128501894-128501916 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
980097313 4:128504692-128504714 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
980871459 4:138615753-138615775 ATGGGGACCTGGAAAGGGGATGG - Intergenic
981353236 4:143756465-143756487 ATGGCTAACAGGAGATGTGAAGG + Intergenic
981362769 4:143866549-143866571 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
981373502 4:143987349-143987371 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
981592247 4:146376602-146376624 ATGGGGAGCTGGAAAGGGGATGG - Intronic
981599653 4:146471955-146471977 ATGGAGAACAGGAAATGGGTGGG - Intronic
982103363 4:151990320-151990342 ATGCCAAAAAGGAATGGGGAGGG - Intergenic
982267719 4:153554881-153554903 ATTGCCAAGAGGAAAGGAGCTGG - Intronic
982918461 4:161244615-161244637 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
984098059 4:175455508-175455530 ATGGGGAACTGGAAAGGGGATGG + Intergenic
984129543 4:175856694-175856716 ATGGGGACCTGGAAAGGGGATGG + Intronic
985228143 4:187784675-187784697 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
985700629 5:1369784-1369806 ATGGCCAACAGGCAATGAAATGG - Intergenic
986071258 5:4286961-4286983 ATGGAAAACAGGAAAGAAGAGGG - Intergenic
986178825 5:5374507-5374529 AAGACCAGCAGAAAAGGGGACGG + Intergenic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
987926597 5:24350209-24350231 ATGGGGAACTGGAAAAGGGATGG + Intergenic
987954085 5:24715547-24715569 AAGGACAAAAGGAGAGGGGAAGG - Intergenic
988001796 5:25358775-25358797 GTGGCCATTGGGAAAGGGGAGGG + Intergenic
988037902 5:25851731-25851753 ATGGGCAGCTGAAAAGGGGAAGG + Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990128405 5:52548322-52548344 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
991207450 5:64065892-64065914 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
991344078 5:65644439-65644461 AAGGCAAAGAGGAAAGGGGTTGG - Intronic
991355940 5:65768712-65768734 AAGGCCAGCAGGGAAGGGAAGGG - Intronic
991425725 5:66489736-66489758 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
991776915 5:70094337-70094359 ATGGTCAACAGGGAAGGGGTTGG - Intergenic
991856202 5:70969782-70969804 ATGGTCAACAGGGAAGGGGTTGG - Exonic
991870218 5:71102576-71102598 ATGGTCAACAGGGAAGGGGTTGG - Intergenic
993447431 5:88030767-88030789 ATGGCCAGCAGGGAACAGGATGG + Intergenic
993619311 5:90149057-90149079 ATGGAAAACAGAAAAGGGCAGGG + Intergenic
994762820 5:103878220-103878242 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
994819290 5:104628132-104628154 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
994999029 5:107103482-107103504 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
995474363 5:112532857-112532879 ATGGCCGACAGGATGGGGGCAGG - Intergenic
995845521 5:116489665-116489687 AAAGCCAAGAAGAAAGGGGAAGG + Intronic
996442872 5:123512038-123512060 ATCGCCGACCGGAAAGGAGACGG - Intergenic
996576729 5:124983967-124983989 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
998791162 5:145767323-145767345 ATGGGGAGCTGGAAAGGGGATGG - Intronic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
999136541 5:149324031-149324053 ATGGCTAACAGGAAAAGTGGAGG - Intronic
999302774 5:150501392-150501414 ATGGCCAAAAGGAGAGGAAAAGG + Intronic
999668495 5:153937322-153937344 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1000742511 5:164987230-164987252 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1000949424 5:167462566-167462588 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1001423204 5:171602617-171602639 CTGGCCAAGAGCAAAGGGCATGG - Intergenic
1001447433 5:171796744-171796766 ATGGCCAAGAGGAAATCGCAGGG + Intergenic
1001679486 5:173545666-173545688 ATGGCGGGCAGGAAAGGTGATGG - Intergenic
1002439348 5:179256275-179256297 GTGCCCAACAGGAAAGAGGACGG + Intronic
1002586632 5:180252815-180252837 ATGAATAACAGGAAAGGGTAGGG + Intronic
1003031712 6:2606751-2606773 AAGGCACACAGGAAAGGAGAAGG + Intergenic
1003194015 6:3899011-3899033 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1004372799 6:15067087-15067109 AGGGCCTGCAGGAAAGGGAAGGG - Intergenic
1004985459 6:21077599-21077621 ATGGCCAGCAGGAAAGGGGCAGG + Intronic
1006726581 6:36203459-36203481 ATGGCCAAGAGGTAGAGGGAGGG + Intronic
1006966454 6:37990837-37990859 GTGGCCAAGAGGAAAGGGTGAGG - Intronic
1008671354 6:53772401-53772423 CTGGCCAACACTCAAGGGGAGGG + Intergenic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1009698485 6:67142583-67142605 ATGGGGAACTAGAAAGGGGATGG - Intergenic
1010494222 6:76513818-76513840 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1010790385 6:80057429-80057451 ATGGCCAACAGGAAGGGAACAGG + Intergenic
1011012481 6:82717516-82717538 ATGGAAAACAGAAAAAGGGAGGG + Intergenic
1011261696 6:85476696-85476718 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1011310140 6:85972566-85972588 CTGGACAAAAAGAAAGGGGAGGG - Intergenic
1011565737 6:88669747-88669769 ATGGGCAGCAGGAAAAAGGATGG - Intronic
1012042978 6:94234048-94234070 ATGGGGAGCAGGAAGGGGGATGG - Intergenic
1012945458 6:105461162-105461184 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1013282062 6:108647717-108647739 TTATCCAAGAGGAAAGGGGAGGG + Intronic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1013796303 6:113893341-113893363 ATGGCCAACAGGGAGGGAGGAGG + Intergenic
1013986215 6:116197290-116197312 TTGGCCACCAGTAAAGGGAATGG - Intronic
1014451306 6:121585162-121585184 ATGACCTACAGGAAAGGGTGGGG - Intergenic
1014635628 6:123843317-123843339 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1014939645 6:127422820-127422842 ATTCCAAAGAGGAAAGGGGAAGG - Intergenic
1015842793 6:137491674-137491696 ATGGCCTACAGAGAAAGGGAAGG - Intergenic
1015876857 6:137831179-137831201 ATGGCCTACAAGAAAGGGCAGGG - Intergenic
1016267206 6:142246563-142246585 GGGGCCACCAGGACAGGGGAGGG - Intergenic
1017633611 6:156422844-156422866 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1017804008 6:157927113-157927135 ATGGAAAACTGGAAAGAGGAAGG + Exonic
1018201437 6:161399168-161399190 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1018353576 6:162988711-162988733 ATGCCAAACAAGAAAGGGAATGG + Intronic
1018661004 6:166087486-166087508 AGTGCCAACAGGGAAGGGAAGGG + Intergenic
1018928072 6:168220926-168220948 ATGGCCAACTTAAAAGGGGTCGG - Intergenic
1019102342 6:169641420-169641442 CTGGCCAACTGAAAAGAGGAGGG - Intronic
1019899460 7:4008575-4008597 AAAGCGAAGAGGAAAGGGGAAGG + Intronic
1020325243 7:6969125-6969147 CTGACCCACAGGAAAGGAGAGGG + Intergenic
1021949362 7:25760004-25760026 ATGGCAAACAGGAGATGGGAGGG - Intergenic
1022172915 7:27846718-27846740 ATGGCCAACAGGATATGAAAAGG - Intronic
1022273872 7:28837496-28837518 AGGGCCCAGAGGCAAGGGGAAGG + Intergenic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1022952641 7:35353169-35353191 TTGACCAATAGGAAAGTGGATGG + Intergenic
1023263220 7:38379218-38379240 GAGGCCAACAGGAGAGGGGAAGG + Intergenic
1024042279 7:45564920-45564942 AAAGGCAACAGGAATGGGGAGGG - Intergenic
1025806702 7:64839588-64839610 ATGGACAAAAGGAAAAAGGAGGG + Intergenic
1026557782 7:71422892-71422914 ATGGGGAGCAGGAAGGGGGATGG + Intronic
1026579410 7:71601470-71601492 AGGGAACACAGGAAAGGGGAGGG + Intronic
1027133846 7:75610613-75610635 TGGGCCTACAGGAAAGGAGAAGG - Intronic
1027706143 7:81535912-81535934 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1027708518 7:81567163-81567185 ATGGGGAGCGGGAAAGGGGATGG - Intergenic
1028052726 7:86206678-86206700 ATGACCACCAAGAAAGGGAAGGG + Intergenic
1028872287 7:95782799-95782821 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1029017277 7:97327507-97327529 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1030322142 7:108180264-108180286 GTGGTCAATGGGAAAGGGGAGGG - Exonic
1030387166 7:108878209-108878231 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1032036426 7:128524905-128524927 ATGCCCAGCAGGAAAGAGGCTGG + Intergenic
1032152347 7:129440126-129440148 ATGGCCAGGAGGAGAGGGAAGGG + Intronic
1033559223 7:142515261-142515283 ATGGTCAACAAGGAAGGAGAGGG + Intergenic
1033767093 7:144505844-144505866 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1034415964 7:150964391-150964413 ATGGGCAAGAGGGAAGGAGAGGG + Intronic
1035824397 8:2629083-2629105 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1036686970 8:10918220-10918242 CTGGCCAGGAGGCAAGGGGATGG - Intronic
1036757212 8:11478842-11478864 ATGCCCAACAGGAAGGGAGTGGG - Intergenic
1037667407 8:20981980-20982002 ATGCCCAACAGGTAAAGGAATGG - Intergenic
1037688097 8:21160966-21160988 AGGGCCTACAGGAAATGGGCAGG - Intergenic
1037753453 8:21697079-21697101 ATGGGACAGAGGAAAGGGGAAGG + Intronic
1038152078 8:24950978-24951000 ATGGCACACAGGATAGAGGATGG + Exonic
1039562896 8:38527385-38527407 ATGGCCACCAGGAAGGTGGCAGG + Intronic
1042162200 8:65908281-65908303 ATGGCCAACATGCACAGGGAAGG + Intergenic
1042514157 8:69642327-69642349 AATGACAACAGGAAAGGTGATGG + Intronic
1042688553 8:71469762-71469784 ATGGCCAAGAGGAAAGTCAAAGG - Intronic
1043658730 8:82707575-82707597 AGGGCCAGAAGGAAAAGGGATGG + Intergenic
1045126007 8:99089778-99089800 AAGACCACCAGGAAAGGGAAAGG + Intronic
1045511219 8:102813324-102813346 ATAGCCAACAGGAACAGGAAGGG + Intergenic
1046765303 8:118062700-118062722 TTTGCCAGCAGGAAAAGGGACGG + Intronic
1047113788 8:121818524-121818546 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1048546747 8:135394735-135394757 CTGGGCAACAGGAAAGGAGCAGG - Intergenic
1048900364 8:139031737-139031759 ATGGGGAGCTGGAAAGGGGAAGG + Intergenic
1049333255 8:142066982-142067004 ATGGCCAACAGGCATGTGAAAGG + Intergenic
1050826386 9:9951580-9951602 ATGCCCTCCAGGCAAGGGGAGGG - Intronic
1051296907 9:15605927-15605949 ATGCCCCACAGGTAAGGGAAAGG - Intronic
1053357071 9:37455321-37455343 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1054353444 9:64040613-64040635 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1054872575 9:70061914-70061936 ATGGACAACAGGAAAGGCCAAGG - Intronic
1055449277 9:76416268-76416290 ATGGGCAGCTGGAAAGGGGATGG - Intergenic
1055869337 9:80855336-80855358 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1057445541 9:95111936-95111958 ATGACCAACAGGAATGTGGCAGG + Intronic
1057920310 9:99091753-99091775 AAGGCATACAGGAAAGAGGATGG + Intergenic
1058093856 9:100836984-100837006 ATGGGCAGCTGGAAGGGGGATGG - Intergenic
1061037427 9:128121397-128121419 AGGGCCAACAGCACAGGTGAGGG + Intronic
1061852491 9:133424245-133424267 AAAGCTAACAGGAAAGGGGCTGG - Intronic
1062405411 9:136393890-136393912 CTGGCCAACAGGAAAAGCCAAGG - Intronic
1203695907 Un_GL000214v1:96717-96739 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1203741777 Un_GL000218v1:9723-9745 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203701966 Un_KI270742v1:4313-4335 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203553949 Un_KI270743v1:190368-190390 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1203640366 Un_KI270751v1:7346-7368 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1185975395 X:4714218-4714240 AAGGGGAACTGGAAAGGGGAGGG - Intergenic
1186036474 X:5428882-5428904 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1186103283 X:6179348-6179370 ATAGCCAAGAGGAAAGGACAAGG + Intronic
1186997381 X:15138383-15138405 AAGGAAAACAGGAAAGGGAAAGG + Intergenic
1187436279 X:19272986-19273008 ATGGACAAAGGGATAGGGGAAGG + Intergenic
1187709612 X:22040206-22040228 AAGGCCAAGAGGAAAGTGAAAGG - Intronic
1187811425 X:23181594-23181616 ATTCCCAACAGGAGAAGGGATGG + Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1189062701 X:37770914-37770936 ATGGAAAACAGAAAAGGGCAGGG + Intronic
1189222015 X:39380735-39380757 CTGGCCAACAGGAAAGATAAGGG - Intergenic
1189234360 X:39476145-39476167 AAGGCAGACAGAAAAGGGGAGGG + Intergenic
1189645115 X:43119924-43119946 ATGGACAAAAAGCAAGGGGATGG - Intergenic
1189994990 X:46629584-46629606 ATGGGAAACAGCAAAGGGGGTGG + Intronic
1190098452 X:47501823-47501845 AATGCCAACAGGAAAGGGTGTGG + Intergenic
1190259767 X:48790545-48790567 AGGGGAAACAGGAAAGGAGAAGG + Intronic
1192089723 X:68140920-68140942 ATGGGGAATTGGAAAGGGGATGG - Intronic
1193709374 X:84860770-84860792 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1194383316 X:93222384-93222406 ATTGCCAAGAGGAATGTGGAAGG - Intergenic
1195286170 X:103386389-103386411 ATGGCCACTGGGAAAGGTGAGGG + Intergenic
1197134130 X:123041338-123041360 ATGACCAAAAGCAAATGGGATGG + Intergenic
1197839927 X:130735291-130735313 ATGGCCCAAAGGAAACTGGAAGG - Intronic
1197967732 X:132082876-132082898 ATGACCAACAGGAAACAGGAGGG + Intronic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198296592 X:135293221-135293243 ATTGCCAACAGAGAAGTGGAGGG - Intronic
1198586228 X:138125115-138125137 ATGGCCTAAAGAACAGGGGATGG - Intergenic
1198713773 X:139534202-139534224 AGGGCCAACATGAAAGGAGTAGG + Intronic
1199575688 X:149311748-149311770 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1200097024 X:153669253-153669275 CTGGCCATCAAGAAAGGGAAGGG + Intergenic
1200912566 Y:8544032-8544054 ATGGGCAGTAGGAAAAGGGATGG - Intergenic
1200981182 Y:9264549-9264571 ATAGCCAAATGGAAATGGGATGG - Intergenic
1201155309 Y:11127177-11127199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1201492152 Y:14553925-14553947 ATAGCCAAAAGGAAAGGACAAGG - Intronic
1201547716 Y:15184253-15184275 ATGGGTAGCTGGAAAGGGGATGG - Intergenic
1201634301 Y:16105092-16105114 ATGGGGAGCTGGAAAGGGGATGG - Intergenic