ID: 938301968

View in Genome Browser
Species Human (GRCh38)
Location 2:130221755-130221777
Sequence TAGAACAAGAAGGTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1594
Summary {0: 5, 1: 40, 2: 125, 3: 349, 4: 1075}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938301962_938301968 3 Left 938301962 2:130221729-130221751 CCCTCACCAATGTGGGCATCATC No data
Right 938301968 2:130221755-130221777 TAGAACAAGAAGGTGGAGGAAGG 0: 5
1: 40
2: 125
3: 349
4: 1075
938301964_938301968 -3 Left 938301964 2:130221735-130221757 CCAATGTGGGCATCATCTGATAG No data
Right 938301968 2:130221755-130221777 TAGAACAAGAAGGTGGAGGAAGG 0: 5
1: 40
2: 125
3: 349
4: 1075
938301963_938301968 2 Left 938301963 2:130221730-130221752 CCTCACCAATGTGGGCATCATCT No data
Right 938301968 2:130221755-130221777 TAGAACAAGAAGGTGGAGGAAGG 0: 5
1: 40
2: 125
3: 349
4: 1075

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938301968 Original CRISPR TAGAACAAGAAGGTGGAGGA AGG Intergenic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900572122 1:3363795-3363817 AAGAAGGAGAAGGAGGAGGAAGG + Intronic
900905674 1:5555436-5555458 TAGCACAAAAAGGCAGAGGAAGG - Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901445175 1:9304081-9304103 TGGAACAAAAAGCTGGAAGAAGG + Intronic
901481037 1:9525421-9525443 TAGAGCAAAAAGGCAGAGGAAGG - Intergenic
902038340 1:13473755-13473777 TACAACAAAAAGGTGGAGGAAGG + Intergenic
902444210 1:16451835-16451857 TAGAACATGAAGAAGAAGGAAGG + Exonic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
902726724 1:18341108-18341130 GAGAAGAAGAAGGAGAAGGAGGG - Intronic
902927471 1:19705711-19705733 TAGAACGGGATGGTGTAGGAGGG + Intronic
903140306 1:21335196-21335218 TGGGACATGAAGGTTGAGGAGGG - Intronic
903414713 1:23174291-23174313 CAGAACAAAAAAGAGGAGGAAGG - Intronic
903746374 1:25589591-25589613 TAGAATAAAATGCTGGAGGAGGG + Intergenic
903989200 1:27253438-27253460 GAGAAGAGGAAGGAGGAGGAAGG - Intronic
904255964 1:29255093-29255115 TAGAGGGAGAGGGTGGAGGAGGG + Intronic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904845346 1:33408916-33408938 TACAACAAGTAGGTGGGAGATGG - Intronic
904968123 1:34396130-34396152 TAGAGCAAAAAGGCAGAGGAAGG + Intergenic
905031500 1:34886929-34886951 AAAAAAAAGAAGGTGGGGGAAGG - Intronic
905462016 1:38128117-38128139 GAGGACAAGGAGGGGGAGGAAGG + Intergenic
905467783 1:38168644-38168666 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
905942921 1:41878689-41878711 TAGAAAGAGAGGGAGGAGGAGGG - Intronic
906055416 1:42912370-42912392 TGGAATAAAAAGGTAGAGGAGGG - Intergenic
906115631 1:43355103-43355125 TAGGACAAGATGGAGAAGGATGG - Intergenic
906260859 1:44388662-44388684 TGGAACAAAAAGATGGAGGAAGG - Intergenic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906773518 1:48507092-48507114 TAGAACAAAAAGGCAAAGGAAGG + Intergenic
906944248 1:50282262-50282284 GAAAAAAAAAAGGTGGAGGAAGG - Intergenic
907256075 1:53180123-53180145 TAGAACAAACAGGCAGAGGAAGG + Intergenic
907313603 1:53553851-53553873 CAGAACGGGCAGGTGGAGGATGG + Intronic
907585967 1:55618249-55618271 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
907703223 1:56810018-56810040 GAGAGAAAGAAGGAGGAGGAAGG + Intronic
907762926 1:57379170-57379192 TAGGAAAAGATGGTGGGGGAGGG - Intronic
907882214 1:58561168-58561190 TAAAACAAGAAAGTGGAAGAAGG + Intergenic
907924719 1:58944598-58944620 GAGAAAAAGAAAGTGGAAGAGGG + Intergenic
907954861 1:59218438-59218460 TAGAACAAAAAAGTAGAAGAAGG - Intergenic
908398666 1:63749812-63749834 TAGAACAGAAAGGTGGGGGAAGG + Intergenic
908413695 1:63891691-63891713 TAGAACAGAAAGATGGAAGATGG + Intronic
908698155 1:66868509-66868531 TAGAATTAGAAGGTGGAGGAAGG + Intronic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
908873703 1:68645505-68645527 TAGAACAAAAACATGGAGGAAGG + Intergenic
908919453 1:69171536-69171558 TAGAACAAGAAGATGAAGGAAGG + Intergenic
909215234 1:72878311-72878333 TAGAAAAAGCAGGTAGAAGAAGG + Intergenic
909253658 1:73390568-73390590 TAGAAGAAGAAGGAGGAAGGAGG - Intergenic
909342251 1:74545238-74545260 TAGAGCAAAAAGGTGCAGGAAGG + Intergenic
909415252 1:75399088-75399110 TAGGAGATGGAGGTGGAGGAGGG + Intronic
909430865 1:75586170-75586192 TAGAACAAAAAGGAGAAGTAAGG + Intronic
909660006 1:78071534-78071556 AAGAAGAAGAAGGAGAAGGAAGG - Intronic
909981403 1:82105843-82105865 TAGAACAAAAAGGCAGAGGCAGG - Intergenic
909997261 1:82295709-82295731 GAGAACAAAAAGGCAGAGGAAGG + Intergenic
910147377 1:84097823-84097845 TATAACAAAAAGGTGGAGAAAGG - Intronic
910149145 1:84120845-84120867 GGGAACCAGAAGGTGGAGGTGGG - Intronic
910202682 1:84715737-84715759 GAAAACAAACAGGTGGAGGAGGG - Intergenic
910204469 1:84734385-84734407 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
910498943 1:87866328-87866350 TAGAAGAAAAAGGTGGAGAAAGG - Intergenic
910769671 1:90818301-90818323 TAGAGCAAAAAGGCAGAGGAGGG - Intergenic
910771947 1:90839751-90839773 TAGAAAAAGATGTTGGAGGGTGG - Intergenic
910909541 1:92218683-92218705 GGGGACCAGAAGGTGGAGGAGGG - Intronic
911268423 1:95771856-95771878 TAGAACAAAAAGGCAGAAGAAGG + Intergenic
911290261 1:96048941-96048963 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
911476670 1:98381638-98381660 TAGAAGAAGAAGTTGAGGGAGGG + Intergenic
911989892 1:104681669-104681691 TAGAACAAGAATTTGGGGGTTGG + Intergenic
912065523 1:105736389-105736411 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
912066187 1:105746558-105746580 TAGAACAAAATGGTAGAGAAAGG - Intergenic
912083085 1:105962626-105962648 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912535429 1:110365291-110365313 CAGAAGAAAAAGGTGGGGGAGGG - Intronic
912604375 1:110973425-110973447 TAGAACAAAAATGTGGAAGAAGG - Intergenic
912666623 1:111586586-111586608 AACAACAAAAAAGTGGAGGATGG + Intronic
912884444 1:113455087-113455109 TAAAAAAATAAGCTGGAGGAAGG + Intronic
913119865 1:115730008-115730030 TAGAACAAGAAAGTGTCAGAGGG - Intronic
913140977 1:115941191-115941213 TACCACAAAAAGGTGGAGGAAGG - Intergenic
913266076 1:117046075-117046097 TAGAACAAAAAGATAGAGAAAGG - Intergenic
913291384 1:117275661-117275683 TAGAACAAAAAGGCAGAGGGAGG - Intergenic
913344163 1:117791481-117791503 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
913379371 1:118191911-118191933 TAGAAAAAGAAGGTTCTGGAGGG + Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914460972 1:147884888-147884910 TAGAACAAAAAGCAGGAGAAAGG + Intergenic
914687068 1:149989749-149989771 AAGAAGAAGAAGGTGGGGGGCGG + Intronic
914787409 1:150847133-150847155 CAGAAAAAGAAGGGGGAGGCTGG + Intronic
914964009 1:152236818-152236840 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915254897 1:154619978-154620000 TAGAACCAGGGGCTGGAGGATGG + Intronic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
916044298 1:160987501-160987523 TAGAGCAAGAGAGTGGTGGATGG - Intergenic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916370527 1:164089341-164089363 TAAAACAAAAAGGCAGAGGAAGG + Intergenic
916418227 1:164612117-164612139 TAGTTCAAGAAGGTGGAGGCGGG + Intronic
916459157 1:165004759-165004781 TGGAACAAAAAGGCAGAGGAAGG - Intergenic
916590667 1:166186922-166186944 TAGAACAATAAGGTAGAGGAAGG + Intergenic
916646894 1:166795701-166795723 TAGAACAAAAAAGTGTAGTAAGG + Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
917219835 1:172717026-172717048 TAGAAAAACAAGCTGGAGGCCGG + Intergenic
917247661 1:173022229-173022251 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
917360882 1:174174773-174174795 TAAAACAAAAAGGCAGAGGAAGG - Intronic
917410661 1:174757010-174757032 ATGGACAAGAAGCTGGAGGAAGG - Intronic
917498547 1:175564827-175564849 CAGAACAAGAAGCTGGCAGAGGG - Intronic
918009904 1:180577073-180577095 TAGAACAAAAAGGCGGAAGAAGG - Intergenic
918179498 1:182074124-182074146 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
918251239 1:182705326-182705348 TAGAATAAAAAGGCAGAGGAAGG - Intergenic
918420182 1:184356440-184356462 TAGAACATCAAGATGGGGGAAGG + Intergenic
918673741 1:187255605-187255627 TAGAACAAAAAGGCAGAAGAAGG + Intergenic
918673879 1:187257487-187257509 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
918693196 1:187508463-187508485 TAGAAGAAGAAGGTAGAGCAAGG + Intergenic
919040965 1:192387895-192387917 TGGAACAAAAAGGTGGAGAAAGG - Intergenic
919193711 1:194256612-194256634 GAGAACAAAAAGGTAGAGGAAGG + Intergenic
919267300 1:195286333-195286355 AAGAAGAAGAAGGGGGAAGAAGG - Intergenic
919411998 1:197257239-197257261 CAGAACAAAAAGGTGGAAGAAGG - Intergenic
920145638 1:203858989-203859011 TCTAAAAAGAAGGTGGGGGAGGG + Intergenic
920410506 1:205756295-205756317 TAGAAAAAGAGAGTAGAGGATGG - Intergenic
920604443 1:207366726-207366748 TAGAACAAAAAAGTGGAGGAAGG - Intergenic
920719788 1:208376428-208376450 GAGAAGTAGATGGTGGAGGATGG - Intergenic
920746542 1:208634432-208634454 TAGAACACAAAGGCAGAGGAAGG + Intergenic
921083616 1:211765979-211766001 GAGAACAAAAAGGTAGAGGAAGG + Intronic
921153010 1:212416587-212416609 TAAATCAAGAAAGAGGAGGATGG - Intergenic
921400208 1:214713699-214713721 TAAAAAAAGAAAGTGGAGGCTGG - Intergenic
921451723 1:215316354-215316376 CAGAACAAGAAGGAGGAATAGGG + Intergenic
921467452 1:215506275-215506297 TAAAACAAAAAGGCAGAGGAAGG + Intergenic
921511656 1:216038490-216038512 TAGAATAAGAAAGTGGAGGGGGG - Intronic
921866100 1:220089118-220089140 AAAAAAAAGAAGGAGGAGGAAGG + Intronic
922170823 1:223153095-223153117 CAGAACAAAAAGGCAGAGGAAGG - Intergenic
922174739 1:223188735-223188757 GAGATAAAGAAGGAGGAGGAAGG + Intergenic
922865626 1:228859193-228859215 TGGAACAAGAAGGTGGAGGAAGG - Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923095240 1:230770327-230770349 CAGAACAAAAAGGCAGAGGAAGG - Intronic
923405315 1:233653589-233653611 TAGAACAAAAAGGGAGAGAAAGG + Intronic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
923925900 1:238626984-238627006 TCGAACAAAAATGTAGAGGAAGG - Intergenic
923957105 1:239034606-239034628 TAGAACAAAAACATGGAAGAAGG + Intergenic
924050063 1:240071492-240071514 TAGAACAGGAGGCTGGAGGTAGG + Intronic
924135063 1:240957162-240957184 TAGGAAAAGCAGGTGGAAGAAGG + Intronic
924177712 1:241409515-241409537 TAGAACGAGAAAGTTGAGTATGG + Intergenic
924417332 1:243870946-243870968 TAGAACAAAAAGCTGGAGGAAGG + Intergenic
924461142 1:244259489-244259511 TAGAACAAAAAGGCAGACGAAGG + Intergenic
924476884 1:244390301-244390323 TAGAACCAAAAGATGGAGGAAGG - Intergenic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924645277 1:245871889-245871911 AAGAAAAAAATGGTGGAGGAGGG + Intronic
924748161 1:246858253-246858275 TAGAAGAAGAAGGTGTTGGCCGG - Intronic
1062936557 10:1394899-1394921 AGGAAGAAGAAGGAGGAGGAGGG - Intronic
1063166993 10:3472311-3472333 TAGAACAAGAATGTCAAGAAAGG + Intergenic
1063437882 10:6049282-6049304 TAGAACAAGAAGGCAGAGGAAGG - Intronic
1063602111 10:7491599-7491621 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063662436 10:8043705-8043727 CAGGGCAGGAAGGTGGAGGAGGG + Intergenic
1063800566 10:9572761-9572783 TAGAACAAAAGGGCAGAGGAAGG - Intergenic
1063804562 10:9623584-9623606 TAGAAAAAGCGGGTGGAAGAAGG - Intergenic
1063877139 10:10492003-10492025 TAGCACAAGAAGTGAGAGGACGG - Intergenic
1063906164 10:10782408-10782430 TAGAACAGAAAGGCAGAGGAAGG - Intergenic
1064334550 10:14426869-14426891 AAGACCATGTAGGTGGAGGAAGG - Intronic
1064364980 10:14699533-14699555 TAGAACAAAATGGTGGAGGAAGG - Intronic
1064366769 10:14715657-14715679 TAGAACAGAAAGGTGGAGGAAGG + Intronic
1064453486 10:15465312-15465334 TAGAACAAAAAAGTAGAGAAAGG + Intergenic
1064521005 10:16200720-16200742 TAGAAGAAAAAGCTGAAGGAAGG - Intergenic
1064581116 10:16794002-16794024 TAGAATAAGAAGGCAGAGGAAGG + Intronic
1064638578 10:17393056-17393078 TAGAACAAAAAAGTGGAGGAAGG + Intronic
1064904775 10:20333917-20333939 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1065077916 10:22099299-22099321 TAGAACAAGAAATTGGAGAAAGG - Intergenic
1065730059 10:28702229-28702251 TTGGACAAGAAGGTGGAACATGG - Intergenic
1065740595 10:28793750-28793772 TACAACAAAAAGGCCGAGGAAGG + Intergenic
1066263462 10:33752002-33752024 TAGAAATACAAGGTGGAGGCTGG + Intergenic
1066289174 10:33998404-33998426 TAGAGCCAAAAGGTGGAGGAAGG + Intergenic
1066393952 10:35001015-35001037 TAGAAGAAAAAGGTGAAAGAAGG + Intergenic
1066553691 10:36587254-36587276 TAAACCCAGAAGGTGGAGGTTGG + Intergenic
1067035993 10:42917530-42917552 TAGAACAAAAAGGTGGGAGAAGG - Intergenic
1067420625 10:46142416-46142438 TAAAACAAAAAGGCAGAGGAAGG - Intergenic
1067421214 10:46150669-46150691 AAGAAAAAGAAGGTAGGGGAGGG + Intergenic
1067425396 10:46207117-46207139 TAAAACAAAAAGGCAGAGGAAGG + Intergenic
1067490417 10:46694557-46694579 TAAAACAAAAAGGCAGAGGAAGG - Intergenic
1067491065 10:46703328-46703350 AAGAAAAAGAAGGTAGGGGAGGG + Intergenic
1067505967 10:46848882-46848904 TAAAACAAAAAGGCAGAGGAAGG - Intergenic
1067506552 10:46857128-46857150 AAGAAAAAGAAGGTAGGGGAGGG + Intergenic
1067564944 10:47329869-47329891 GAGAACAAGAAGGTGGTGGTAGG - Intergenic
1067603600 10:47637038-47637060 AAGAAAAAGAAGGTAGGGGAGGG - Intergenic
1067604246 10:47645808-47645830 TAAAACAAAAAGGCAGAGGAAGG + Intergenic
1068045668 10:51883086-51883108 TAGAACAAAAAGGTGGAAAAAGG + Intronic
1068235605 10:54228709-54228731 TAGAACAAAAAGGCAGAGGAAGG - Intronic
1068393741 10:56433544-56433566 AAGAAAAAGAAGGTAGGGGAGGG - Intergenic
1068394996 10:56448785-56448807 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1068465678 10:57387388-57387410 TAGAACAAAGAGGCAGAGGAAGG - Intergenic
1068543385 10:58320896-58320918 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1068558229 10:58482080-58482102 GAGAAGAAGAAGGCAGAGGAGGG - Intergenic
1068761148 10:60710910-60710932 TAGAACAAAAAGGCAGAGGAAGG - Intronic
1069194429 10:65531361-65531383 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1069291420 10:66785438-66785460 TAGAACAAAAAGACAGAGGAAGG + Intronic
1069372010 10:67758051-67758073 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070412574 10:76156450-76156472 AAGAACAAGAGGGTGGACTAGGG + Intronic
1070500406 10:77067237-77067259 TAGAATAAAAAGGAGGAGTAAGG + Intronic
1070699810 10:78593504-78593526 TAATAAAAAAAGGTGGAGGAAGG - Intergenic
1070861078 10:79662733-79662755 TATAACAAGCATGTGGAGGCAGG - Intergenic
1070887391 10:79915896-79915918 TAAAACAAAAAGGCAGAGGAAGG - Intergenic
1071093286 10:81945270-81945292 AGGAAAAAGAAGGAGGAGGAAGG - Intronic
1071360464 10:84841363-84841385 TAGGACAAAAAGGTAGAGGAAGG + Intergenic
1071420314 10:85489906-85489928 CAGAAAAAGAGGTTGGAGGAAGG + Intergenic
1071456952 10:85858213-85858235 TGTAACAGGTAGGTGGAGGATGG + Intronic
1071643109 10:87335005-87335027 TATAACAAGCATGTGGAGGCAGG + Intergenic
1071827351 10:89338395-89338417 TAGAACAAAAAGGCAGAGGAAGG - Intronic
1071953822 10:90735226-90735248 TAGAGCGAAAAGGTGGAGGAAGG - Intergenic
1072036636 10:91568934-91568956 TAGAACAAAAAGGTGGAAGAAGG - Intergenic
1072171288 10:92864659-92864681 TGGAATAAAAAGGTGAAGGAAGG + Intronic
1072515023 10:96172540-96172562 TGTAACAATAAGGTGGGGGAGGG + Intronic
1073586466 10:104715278-104715300 TAGAACAAAAAGGAGGAGAAAGG + Intronic
1073603439 10:104869380-104869402 TACAACAAAAAGGCAGAGGAAGG - Intronic
1073830815 10:107380843-107380865 TAGAACAAAATGGTAGAGGAAGG - Intergenic
1073919273 10:108440563-108440585 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1073951882 10:108818914-108818936 TAGAACCAAAAGGTGGAGGAAGG + Intergenic
1073967874 10:109012480-109012502 TAGAACAAAAATGCAGAGGAGGG - Intergenic
1073976216 10:109104514-109104536 TAGAACTAAAAGGTGGAGGAAGG - Intergenic
1074212038 10:111344141-111344163 TAGAAGAAAAAGATGGAGGAAGG - Intergenic
1074260240 10:111846349-111846371 TAGAAGAAAAAGGTAGAGAAAGG - Intergenic
1074370445 10:112896572-112896594 TAGAACAAAAAGGCAGAAGAAGG - Intergenic
1074512871 10:114133941-114133963 AAGAAAAAGAAAGTGGAGAAAGG + Intronic
1074697182 10:116059984-116060006 AAGAACAAGGTGGTGGAGGGAGG + Intronic
1074804067 10:117029671-117029693 AGGAGCAAGAAGGTGGAGGGAGG - Intronic
1075134006 10:119766176-119766198 TAGAACAAAAAGGCAGAGGATGG - Intronic
1075593486 10:123709897-123709919 GAGAACAAGAAGATGGAAAATGG + Intronic
1076413399 10:130267537-130267559 GAGGACCTGAAGGTGGAGGAAGG - Intergenic
1077878831 11:6331477-6331499 TAGAAATAAAAGGTGGAGGCCGG + Intergenic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078452874 11:11453281-11453303 TTTAACAAGAAGGTGGCGGAAGG - Intronic
1078767773 11:14316102-14316124 TAGTCCAAGATGGTGGAAGAAGG - Intronic
1079540424 11:21566245-21566267 TAAATCAAGAAGGTGGACGTAGG - Intronic
1079649175 11:22905409-22905431 TAAAACAAGAAGATGGAAGGAGG - Intergenic
1080019853 11:27549068-27549090 TAGAACTAAAAGGTGGAGAAAGG - Intergenic
1080038864 11:27738083-27738105 CAGAAGAAGAAGGTCAAGGATGG - Intergenic
1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG + Intergenic
1080121678 11:28685137-28685159 TCGAACAAATAAGTGGAGGAGGG + Intergenic
1080290546 11:30666053-30666075 TAGAACAAGAAGAAGGAGAAGGG + Intergenic
1080308151 11:30858935-30858957 GAGAACAAGAAGCTGAAGGTAGG - Intronic
1080411888 11:32032944-32032966 AAAAAAAAGAAGGTGGAGGGAGG - Intronic
1080412702 11:32040897-32040919 TAGAAAAAGGAGGGTGAGGAGGG - Intronic
1080534232 11:33206019-33206041 TAGAACAACAAGATGGAGAAAGG + Intergenic
1080783906 11:35457251-35457273 TAGAATAAAAAGGTGCAGGAAGG + Intronic
1080894730 11:36439730-36439752 GAGAACAAAAAGGAGGAGGAAGG - Intronic
1080907539 11:36561628-36561650 TAGAACAAAAAGGAGGAGGAAGG + Intronic
1080907725 11:36563313-36563335 TAGAACAAAGAAGTGGAGGAAGG + Intronic
1081044414 11:38253554-38253576 TAGAACAAAAAAGTGGAAGAAGG - Intergenic
1081085451 11:38794706-38794728 TAGAACACCAAGGTGGGGTAAGG + Intergenic
1081482673 11:43504229-43504251 GAGAACAGAAAGGAGGAGGAAGG - Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082733698 11:56831760-56831782 AAATACAAGAAGGAGGAGGAAGG + Intergenic
1082913276 11:58401856-58401878 AAGAACAAAAAGGTGGAGGAAGG - Intergenic
1083060744 11:59868332-59868354 TAGAATAAAATGGTGAAGGAAGG + Intergenic
1083903232 11:65654055-65654077 GAGTACCAGAAGCTGGAGGATGG + Exonic
1084365359 11:68694010-68694032 TAGAGCAAGTAGGAGGTGGACGG - Intergenic
1084370210 11:68736784-68736806 GAGAACAAAGAGGAGGAGGAGGG + Intronic
1084629125 11:70334241-70334263 TTTAACAAGTAGGTGGAGAAAGG + Intronic
1085760657 11:79238404-79238426 TAGAACAAAAAGGCAGAGGGAGG + Intronic
1085969438 11:81569080-81569102 GTGAACAACAAGGTGGAGCAGGG - Intergenic
1086196184 11:84142653-84142675 TAGAACAAAAAGGCAGAGGAAGG + Intronic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086403342 11:86479127-86479149 TAGAACAAAAAGGCAGAGGAAGG + Intronic
1086419360 11:86623204-86623226 TAGAACAAAAAGGCAGAGGAAGG + Intronic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1086904658 11:92404809-92404831 TAGAACAAAAAGGCAGAAGAAGG + Intronic
1086965800 11:93026895-93026917 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1087017581 11:93569017-93569039 GAGAACATAAAAGTGGAGGAAGG - Intergenic
1087438832 11:98157613-98157635 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1087558145 11:99748751-99748773 TAGAACAAAAAAGTAGAGAAAGG - Intronic
1087952490 11:104240154-104240176 TCTAACAAAAAGGTGGAAGAAGG + Intergenic
1087973609 11:104516604-104516626 AAGAAAAAGAAGATGGAGAAAGG - Intergenic
1087982403 11:104632169-104632191 TAGAAGAAAAAGGTGGAGTAAGG + Intergenic
1088068801 11:105755762-105755784 TAGAACAAAAATTTGGTGGAAGG + Intronic
1088156535 11:106811323-106811345 TAGAAAAGGAAGGTGGAGCTGGG + Intronic
1088187689 11:107191247-107191269 TAGAACAACAAAGTGGAGGAAGG - Intergenic
1088384558 11:109239017-109239039 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1088502305 11:110494604-110494626 TAAAACAAAAAGGAGGAGAAAGG - Intergenic
1088763369 11:112952853-112952875 TAGAAAAAGCAAGGGGAGGAGGG - Intergenic
1089136286 11:116251903-116251925 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
1089378597 11:118012100-118012122 TAGAGCAAGTGGGAGGAGGAGGG - Intergenic
1089535756 11:119160092-119160114 TTGAACAAGAATGTGGAGGCAGG + Intronic
1089589234 11:119529936-119529958 TAGAAACAGCAGCTGGAGGAAGG - Intergenic
1090013207 11:123062739-123062761 TGGAACACGAAGGTGGGGCATGG - Intronic
1090059118 11:123448513-123448535 TAGAAGTAGAAAGTGGAGGCTGG - Intergenic
1090180953 11:124698996-124699018 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090564482 11:127972395-127972417 TAGAACAAAAATGTGTAGAAAGG - Intergenic
1090569310 11:128029751-128029773 TAGAAGTACAAGGTGCAGGATGG + Intergenic
1090765762 11:129874678-129874700 TAGGACAAGATGGTAGAGGCAGG - Intronic
1090818960 11:130323815-130323837 TAGAACAAAAAGGTGAAGGAAGG + Intergenic
1090843334 11:130511783-130511805 AAGAACAAAAAGGCTGAGGAAGG - Intergenic
1091028119 11:132160067-132160089 TAGAAAAACAAGGTGGGAGAAGG - Intronic
1091405276 12:204784-204806 AAGAACAGGATGGTGGAGGGCGG - Intronic
1091450472 12:569512-569534 TAGACCAGGAAGGAGGAGAAAGG - Intronic
1092445857 12:8556576-8556598 TAGAACAAAAAGGTGGAAAAAGG + Intergenic
1092695220 12:11164257-11164279 TAGAACAAAAAGCTGGAGGAAGG + Intronic
1092742322 12:11641715-11641737 TAGAACAAAAGGGTGGAGGAAGG + Intergenic
1092781583 12:11992621-11992643 TAAAACAAAAAGGAAGAGGAAGG - Intergenic
1092937378 12:13376678-13376700 TAGAACTAAAAGGAAGAGGAAGG - Exonic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093160314 12:15739499-15739521 TGGAACAAAAAGGTGGAGGAAGG + Intronic
1093364823 12:18280928-18280950 TAGAAGAAGAAAGATGAGGAAGG + Intronic
1093463463 12:19427076-19427098 TAGAATAAAAAGGCAGAGGAAGG + Intronic
1093545275 12:20338063-20338085 TAGAACAAAGAGGTAAAGGAGGG - Intergenic
1093628757 12:21383458-21383480 TAAAGCAAGAACGTGGAGGCAGG - Intronic
1093754968 12:22842202-22842224 GAGAAGGAGAAGGAGGAGGAGGG - Intergenic
1093771814 12:23026869-23026891 TAGAACAAAAATGTGGAGGAAGG + Intergenic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094221219 12:27995664-27995686 TTAAACAAGAAGGAAGAGGAGGG - Intergenic
1094540990 12:31363082-31363104 TAATAGAAGGAGGTGGAGGAAGG + Intergenic
1094628262 12:32146926-32146948 AGGAAGAAGAAGGAGGAGGAAGG - Intronic
1095341009 12:41088252-41088274 TAGAACAAAGAGGTAGAGGAAGG - Intergenic
1095385472 12:41644918-41644940 TACAACAGAAATGTGGAGGAAGG + Intergenic
1095729198 12:45487689-45487711 TAGAACAAAAAGGTGGAGGAGGG - Intergenic
1095732455 12:45521002-45521024 TGGAACAAAAAGGAAGAGGAAGG - Intergenic
1095739147 12:45588192-45588214 TAGAACTAAAAGGCAGAGGAAGG + Intergenic
1095850380 12:46797351-46797373 TAGAACAAAAAGGCAGAGGAAGG + Intronic
1096494542 12:52032274-52032296 TAGAATAAAAAGGCAGAGGAAGG + Intronic
1096516138 12:52156629-52156651 TTGAATAGGAAGGTGGCGGATGG + Intergenic
1096572164 12:52529884-52529906 GAGACCATGAAGGTGGAAGAGGG - Intergenic
1096663522 12:53145757-53145779 TAGAACAAAAAGGTGAGGAAAGG - Intergenic
1096813963 12:54189860-54189882 TAGAACAAAAGAGTGGAGGAAGG - Intergenic
1096865757 12:54561653-54561675 GAGAAGAGGAAGGGGGAGGAGGG + Intronic
1097138155 12:56876676-56876698 GAGCACAAGAAGGTTGAAGAGGG - Intergenic
1097318792 12:58202629-58202651 TTGAACAAAAAGATGGAGGAAGG - Intergenic
1097533120 12:60831028-60831050 TAGACCAAAAAGGCAGAGGAAGG - Intergenic
1097618866 12:61915780-61915802 TAGAACAAAAAGGTGAAGGAAGG - Intronic
1097677113 12:62614801-62614823 AAGAAAAAGAAGGAAGAGGAAGG - Intergenic
1098031196 12:66256630-66256652 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
1098158672 12:67626131-67626153 GAGAACAAAAGGGAGGAGGAAGG + Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098684532 12:73401606-73401628 GAGAACAAAAATGTGGAGGAAGG + Intergenic
1099171981 12:79375887-79375909 TAGAACTACAAGGTGGGAGATGG - Intronic
1099258505 12:80346317-80346339 TAGAAGCAGAAGGTAGAGAAAGG - Intronic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099472006 12:83062020-83062042 TAGAAAAAGAAGCTTGAGGCCGG - Intronic
1099558095 12:84136398-84136420 TAGAATAAGAAAGTGGAGAAAGG - Intergenic
1099742945 12:86665050-86665072 TAGAACAAGGTGGTGGGGGGAGG - Intronic
1099821702 12:87719611-87719633 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1100033867 12:90226568-90226590 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
1100039909 12:90302934-90302956 GAGAACAAAAAGGTGGAAGAAGG - Intergenic
1100126977 12:91439046-91439068 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1100387357 12:94115970-94115992 AAGAAAGAGAAGGTGGAGAAAGG - Intergenic
1100800334 12:98224090-98224112 GAGAACAAAAAGGCAGAGGAAGG - Intergenic
1100906103 12:99301153-99301175 TAGAATGAAAAGGTGAAGGAAGG - Intronic
1100957080 12:99920795-99920817 TAGAACAAGAAAGTGGAGGAAGG - Intronic
1101062458 12:100986367-100986389 TAGGACAAAAAAGTGGAGGCAGG - Intronic
1101122015 12:101591978-101592000 TAGAGCAAGAAGGAGGAGTCTGG + Intronic
1101236132 12:102792224-102792246 TAGAACAAAAAGGTGGTGGAAGG - Intergenic
1101302174 12:103494501-103494523 TAAAATAAAAAGGAGGAGGATGG + Intronic
1101398416 12:104367858-104367880 TAGAAGAAAAAGGTGGAGGAAGG + Intergenic
1101440097 12:104697402-104697424 TCAAACAAAAAGGTGGAGGAAGG + Intronic
1101555438 12:105804729-105804751 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
1101662494 12:106778181-106778203 TAGAAAAAGAAGGGGAAGAATGG - Intronic
1101693011 12:107098350-107098372 AAGAAAAAGAAGGGGGAGGGAGG + Intergenic
1101793922 12:107955676-107955698 TTGAATATGAGGGTGGAGGATGG + Intergenic
1101960834 12:109248632-109248654 TAGAAAAAGCAGGTGAAAGAAGG - Intronic
1102295255 12:111731348-111731370 TGGAGAAAGAAGATGGAGGAGGG - Intronic
1102666474 12:114578248-114578270 TAGAACAGAAAGGTGGAGGAAGG + Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102952599 12:117040540-117040562 AAGAGCTAGAAGGTGGAGGAGGG - Intronic
1103155856 12:118684406-118684428 CAGAACAAGAGGGTGGAAGAAGG - Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103412462 12:120722162-120722184 TAGAAAGAGGATGTGGAGGAAGG + Exonic
1103425656 12:120831041-120831063 CAGAACAAAAAGGCGGAGGAAGG + Intronic
1103731867 12:123033142-123033164 TACAGCAAGAAGCTGGAGGAGGG + Intronic
1103770122 12:123315929-123315951 AAGAACATGAAGATGGAGGGAGG + Intronic
1104192283 12:126493607-126493629 CAGAAAAACAGGGTGGAGGAGGG + Intergenic
1104241357 12:126993249-126993271 TAGAAAAAGCAGGTGGCAGAAGG + Intergenic
1104241570 12:126994752-126994774 TAGAAAAAGCAGGTGGCAGAAGG - Intergenic
1104272137 12:127292177-127292199 TAGAACAAAAGGGTGGAGGAAGG + Intergenic
1104374321 12:128250523-128250545 CAGGACAAGAAGGCAGAGGAAGG + Intergenic
1104503020 12:129303950-129303972 CAGAACACAAAGGTGGAGGCAGG - Intronic
1104726715 12:131082154-131082176 CAGAAACAAAAGGTGGAGGAAGG - Intronic
1104984750 12:132590335-132590357 TAGAACAAAAATGTAAAGGAGGG - Intergenic
1105236947 13:18565549-18565571 CAGAACAAAAAGGCAGAGGAAGG + Intergenic
1105340017 13:19513884-19513906 AAGAGCATGAAGGTGGTGGAGGG - Intronic
1105415806 13:20210526-20210548 TAGAAGGACAGGGTGGAGGAAGG + Intergenic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1105754788 13:23454244-23454266 TAGAATAATAAGGCTGAGGAAGG - Intergenic
1105853155 13:24353590-24353612 TAGAACAAAAAGGCTGAGGAAGG - Intergenic
1105896337 13:24719653-24719675 AAGAAGCAGAAGGAGGAGGAGGG + Intergenic
1106093927 13:26625563-26625585 CAGAACAAAAGAGTGGAGGAAGG - Intronic
1106122097 13:26868836-26868858 TAGGTCAAGAAGGAAGAGGATGG - Intergenic
1106221948 13:27753624-27753646 TAGAAAAAAAAGGTGGAAGAAGG - Intergenic
1106601379 13:31190116-31190138 TAGCAAAATAAGGTGGATGAAGG - Intergenic
1106653701 13:31719535-31719557 TGGAATAAAAAGGTAGAGGAAGG - Intergenic
1106875150 13:34063847-34063869 TAAAACAAAAAGGTGAAGGAAGG - Intergenic
1106929467 13:34648251-34648273 GAGAAGAAGAAGATGGGGGAGGG + Intergenic
1107012085 13:35679628-35679650 TCCAACAAAAAGGTGGAGGAAGG - Intergenic
1107164761 13:37271260-37271282 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1107718820 13:43227106-43227128 TAGAACAAGTCAGAGGAGGATGG + Intronic
1107766643 13:43742473-43742495 TAGACAAATAAGATGGAGGAAGG - Intronic
1107825106 13:44322001-44322023 TAGAACAAAAAGGTGAAGAAGGG - Intergenic
1107827500 13:44342030-44342052 GAGAACAAAAAGCAGGAGGAAGG + Intergenic
1107874557 13:44778765-44778787 TAGAAAGAGAAAGAGGAGGATGG + Intergenic
1108009679 13:45992790-45992812 CAGAACAAAAAGGTGAAGGAAGG + Intronic
1108067000 13:46588460-46588482 TACAATAAAAAGCTGGAGGAAGG - Intronic
1108068718 13:46605549-46605571 AAGAAAAATGAGGTGGAGGAAGG - Intronic
1108117341 13:47143994-47144016 GAGTACAAGAAGGTGGAGCATGG + Intergenic
1108291034 13:48961370-48961392 GAGAAGAAGAAGGAGGAAGAGGG + Intergenic
1108718518 13:53105962-53105984 TAGAACAGAAAGGAAGAGGAAGG + Intergenic
1108841889 13:54628032-54628054 TGGGACAAAAAGGTGGAGGAAGG - Intergenic
1108937528 13:55902199-55902221 GAGACCCAGAAGGAGGAGGATGG + Intergenic
1109239474 13:59867180-59867202 TAAAACAAGATGGTTGAGGCAGG + Intronic
1109314895 13:60738888-60738910 TAAAACAAAAAGGTAGAGGAAGG + Intergenic
1109640219 13:65181616-65181638 TAGAACAAAAAGGTGGAAGAAGG + Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1109860451 13:68191081-68191103 TAGAAAAAGCAAGTGGAAGAAGG + Intergenic
1109909034 13:68885929-68885951 TAGAACAAAAAGGTGAAGGAAGG + Intergenic
1110348583 13:74478788-74478810 TAGAAGAAAAAGATGGAAGAAGG - Intergenic
1110504290 13:76267492-76267514 TAGAAGGAGAAGGAGGAGGAAGG + Intergenic
1110541764 13:76713913-76713935 TGGAACAAAAAAATGGAGGAGGG + Intergenic
1110544121 13:76737404-76737426 TAGAAAAAGAGAGTGGAGGCTGG - Intergenic
1110664168 13:78096397-78096419 TAGAACAAAAAGGAGAAGGAAGG + Intergenic
1110999256 13:82157324-82157346 TAGAAGAAAAAGGTGGAGGAAGG - Intergenic
1111252130 13:85615418-85615440 AAAAAAAAGAAGATGGAGGAAGG - Intergenic
1111279582 13:86003258-86003280 TAGAACAAAAAGGTAGAAAAGGG + Intergenic
1111807421 13:93054611-93054633 TAGAACAAGTTGGTGGGGCACGG - Intergenic
1111942350 13:94624103-94624125 TAGCACAAGAAGGTCAAGAAAGG - Intronic
1112016086 13:95332558-95332580 TAGAAGAAAAAAGTGGAGGAAGG + Intergenic
1112806254 13:103166746-103166768 TAGAACAGGAAGATGGGAGATGG - Intergenic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113321995 13:109243015-109243037 TAGAACACAGAGGAGGAGGAAGG + Intergenic
1113329762 13:109316832-109316854 TGGAACAGGAAGGTGCAGAAAGG - Intergenic
1113439860 13:110319890-110319912 TACAACAGGAAGGAGGAGGCCGG - Intronic
1113898837 13:113784545-113784567 AAGAAGAAGAAGGAGGAGAAGGG + Intronic
1114038128 14:18648832-18648854 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
1114120485 14:19666204-19666226 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114201219 14:20522569-20522591 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114339970 14:21733136-21733158 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
1114526779 14:23371483-23371505 TAGAAGAAGCAGGTGGTGGCTGG - Intergenic
1114635449 14:24184440-24184462 TAGCACCAGGAGGTGGAGGTGGG + Intronic
1114667508 14:24388326-24388348 TAGAACAAAAAAGTAGAGGAAGG + Intergenic
1114708289 14:24750190-24750212 TAGAACTAACAGGTGGAGAAAGG + Intergenic
1115006701 14:28494329-28494351 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1115125904 14:29993529-29993551 TAGAACAAAAAGTTGAAGGAAGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1115742503 14:36403341-36403363 CAGAACAAAAAGGTGAAGGAGGG + Intergenic
1115748084 14:36459132-36459154 TAGAGCAGGTAGGGGGAGGAAGG - Intergenic
1115919641 14:38358322-38358344 TAGAACGAGAAGTTTGAGCAAGG - Intergenic
1116025902 14:39514344-39514366 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
1116430616 14:44841550-44841572 CAGAACAAAAAGGCAGAGGAAGG + Intergenic
1116521152 14:45848660-45848682 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1116755582 14:48943982-48944004 CAGAAAAGGAAAGTGGAGGAGGG - Intergenic
1116981400 14:51174728-51174750 TAGAACAAAAAGACAGAGGAAGG + Intergenic
1117094343 14:52282300-52282322 TAGAACATGCAGGAGAAGGAGGG - Intergenic
1117267092 14:54100675-54100697 TAGGACAAAAAGGCAGAGGAGGG + Intergenic
1117442643 14:55774277-55774299 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1117553334 14:56858110-56858132 GAGAGAAAGAAGGAGGAGGAGGG + Intergenic
1117779804 14:59220829-59220851 TAGAACAAAAAGGCAGAGGAAGG - Intronic
1118416408 14:65541570-65541592 TTAAACAAAAAGGTTGAGGATGG - Intronic
1118469422 14:66061351-66061373 TAGAACAAAAAAGTGAAGAAAGG - Intergenic
1118571838 14:67201876-67201898 TAGAAGAAGAGACTGGAGGATGG - Intronic
1118750614 14:68805580-68805602 TAGAAACAGAAGGGGGAAGAAGG + Intergenic
1118848015 14:69562738-69562760 ATGAACAAGGAGGTAGAGGAGGG + Intergenic
1118931002 14:70240352-70240374 TGGGACAAGAAGATGGAGGGTGG - Intergenic
1119147200 14:72328129-72328151 TAGAACAAAAAGAAGGAGGAGGG - Intronic
1119722332 14:76899645-76899667 TAGAACAAGAGTGAGGAGGGCGG + Intergenic
1119770195 14:77215820-77215842 TAGAAGAAGTAGGAGGAGGGGGG - Intronic
1119971791 14:78979047-78979069 TAGAAGAAAAAGGCAGAGGAAGG - Intronic
1120066654 14:80048994-80049016 TACAACAAGAAGGTGGAGAAAGG + Intergenic
1120068331 14:80072596-80072618 TAGTACAAAAAGGCAGAGGAAGG + Intergenic
1120650576 14:87127784-87127806 TAGCACAAAGAGATGGAGGAAGG + Intergenic
1120811622 14:88809154-88809176 TAGAACAAAAAGGCAAAGGAAGG + Intergenic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121153669 14:91663074-91663096 GAGGAGAAGGAGGTGGAGGAGGG - Intronic
1121220347 14:92280190-92280212 TAGAACAAAAAGGTGCAGGAAGG - Intergenic
1121447505 14:93988150-93988172 TAGAAGGAGGAGTTGGAGGAGGG + Intergenic
1121573918 14:94967761-94967783 TAGAACAGAAAGGTAGAGGAAGG - Intergenic
1121674846 14:95744099-95744121 CAGAACAAGAAGGTAGAGGAAGG + Intergenic
1121710462 14:96034939-96034961 TAGAACAAAAATCTGGAAGAGGG - Intergenic
1122181133 14:99955624-99955646 CAGAACAAAAAGGTAGAGGAAGG + Intergenic
1122324748 14:100875481-100875503 GAGGACAAGAGGGTGCAGGAGGG + Intergenic
1122410086 14:101521400-101521422 TAGAATCAGGAGGTGGGGGAGGG + Intergenic
1122581563 14:102775021-102775043 GAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1123019909 14:105392833-105392855 AAGAACAAGAAGGGTGAGGTGGG + Exonic
1123705010 15:22944920-22944942 CAGAACGAGATGCTGGAGGAGGG - Exonic
1123787638 15:23688747-23688769 GAGAAGGAGGAGGTGGAGGAGGG - Intergenic
1123986460 15:25650572-25650594 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1124203709 15:27699587-27699609 TAGATATAGAAGGTGGAAGAGGG + Intergenic
1124401690 15:29354124-29354146 TAGAACAAAAAGGCAGAGGAAGG + Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124862677 15:33458288-33458310 TAGAACAAAAAAGTGGAAGAAGG + Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125303880 15:38288211-38288233 CAGAAGAGGAAGGTAGAGGAAGG + Intronic
1125392470 15:39209116-39209138 TAGAACAAAAAAGTGGAGGAAGG + Intergenic
1125458461 15:39885409-39885431 TAGAGCAAGGAGGTGGGGGATGG - Intronic
1125582570 15:40797061-40797083 TAGAACAAGAAATTAGAGTAGGG + Intronic
1126535858 15:49763425-49763447 AAGAACAGAAAGGTGAAGGAAGG + Intergenic
1126540051 15:49812544-49812566 GAGAAAAAGAAGGAAGAGGAGGG - Intergenic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1127040506 15:54970461-54970483 TAGGACAAAAAGGTAGAGGAAGG - Intergenic
1128339225 15:66808762-66808784 AAGAACAAGAAGCTGGAGGAAGG + Intergenic
1128380170 15:67106529-67106551 TAGAACTACAAGCTGGAGTAGGG - Intronic
1128538374 15:68507607-68507629 TGGAACAAAAAGGTGGAGAGAGG + Intergenic
1128662291 15:69510912-69510934 TGGAACAAAAAGATGGGGGAAGG + Intergenic
1130029252 15:80296680-80296702 TGAAACAAAAAGGCGGAGGAAGG - Intergenic
1130068641 15:80628051-80628073 TGAAACAAAAAGGTGGAGGAAGG + Intergenic
1130080023 15:80724754-80724776 GAGAAGGAGAAGGAGGAGGAGGG - Intronic
1130196998 15:81789150-81789172 TATAACAAAAAGGCAGAGGAAGG - Intergenic
1130206789 15:81883848-81883870 AATAACAAGACAGTGGAGGAGGG + Intergenic
1130379117 15:83356817-83356839 GAGAAGAGGACGGTGGAGGAGGG - Intergenic
1130661355 15:85833719-85833741 CAGAACAGGAAGGGGAAGGAGGG + Intergenic
1130920588 15:88340919-88340941 CAGAACAAAAAGGCAGAGGAAGG + Intergenic
1130933527 15:88449602-88449624 TAAAGCAAGAAGGTGGAGGCAGG + Intergenic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131284836 15:91048185-91048207 AAGAAGAAGAAGGAGGGGGAGGG - Intergenic
1131312606 15:91304566-91304588 GAGAAAAAGAGGGAGGAGGAAGG + Intergenic
1131513201 15:93060949-93060971 GAGACCAAGAAGGTGGCGCAGGG - Intronic
1131714086 15:95089717-95089739 TAGAAAAAGAAGGGGGAGGAGGG + Intergenic
1131901749 15:97095219-97095241 TATAATAAGAAAGTGGAGGAAGG - Intergenic
1131975651 15:97943313-97943335 TAGAACAACAAGGCAGAGGAAGG - Intergenic
1131997195 15:98144162-98144184 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
1132141126 15:99396895-99396917 TAGAACAAAAATGTACAGGAAGG + Intergenic
1132152362 15:99471537-99471559 TAGAATAGAAAGGTGAAGGAAGG + Intergenic
1132200166 15:99947465-99947487 AAGAGCATGAAGATGGAGGAGGG - Intergenic
1132203103 15:99968625-99968647 TAGAACAGGAAGGCTGACGAAGG + Intergenic
1132739300 16:1403453-1403475 TAGAACAGGAATCTGGAAGAAGG - Intronic
1133160955 16:3911364-3911386 TAGCACAAAAAGGCTGAGGAGGG - Intergenic
1133194435 16:4158970-4158992 GAGAAAAAGAAGGTGGAGTTGGG + Intergenic
1133407246 16:5534611-5534633 TAAAAAAAGCAGGTGGAAGAAGG - Intergenic
1133659999 16:7907083-7907105 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1133695160 16:8256252-8256274 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1133702364 16:8320836-8320858 TAGAACAAAAAGATGGTGGAAGG + Intergenic
1133850100 16:9495422-9495444 TAGAGCAAAAAGGCAGAGGAAGG + Intergenic
1133943557 16:10329924-10329946 TAGAACATGTAGGTGGAGACTGG - Intronic
1133984059 16:10654556-10654578 CAGAACAAAAAGGCAGAGGAAGG + Intronic
1134347267 16:13402439-13402461 TAGAACAAAAAAGCGGAGGAAGG - Intergenic
1134699802 16:16255687-16255709 AAGAACAAGAAGGTGCTCGAAGG - Intronic
1135128014 16:19827705-19827727 TAGAACAAAATGGTGGAGGAAGG + Intronic
1135302176 16:21340091-21340113 AAGAACAAAAGGGTGGAGGAAGG - Intergenic
1135380509 16:21992538-21992560 TAGAAAAAGCAGGTGGAAAAAGG + Intronic
1135529686 16:23242337-23242359 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1135531638 16:23259709-23259731 TAGAAACAGAAGTTGGAGAAGGG + Intergenic
1135626320 16:23998088-23998110 CAGAACAAAAAGGCAGAGGAAGG + Intronic
1135660372 16:24291497-24291519 GAGAGCAAGAAGATGGAGGTGGG + Intronic
1135790859 16:25394052-25394074 TAGAACAAAAAGTCAGAGGAAGG - Intergenic
1135917147 16:26615398-26615420 TAAAATAAAAAGGTGTAGGAAGG + Intergenic
1135935837 16:26779269-26779291 TAAAAAAAGAAGGTGGGGGGTGG + Intergenic
1135942452 16:26834310-26834332 GAGAAGAAGAAGGAGGGGGAGGG + Intergenic
1135962850 16:27012220-27012242 CACACCAAGAAGGTGGTGGAAGG - Intergenic
1136032160 16:27511216-27511238 CAGAACAAGAAGCCAGAGGAAGG + Intronic
1136539109 16:30918756-30918778 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1137332660 16:47514514-47514536 TGGAACAAAAAGGCAGAGGAAGG - Intronic
1137386460 16:48047351-48047373 GAGGAGAAGGAGGTGGAGGATGG + Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137822108 16:51456062-51456084 GAGAAGAAGAAGGAGGAGCAGGG + Intergenic
1137897169 16:52226509-52226531 TAGAACAAGAAAATAGAGGAAGG - Intergenic
1137968358 16:52959108-52959130 AAGAAGAAAAAGGAGGAGGAGGG - Intergenic
1138238199 16:55403499-55403521 TAGAACAAAAAGGCAGAGGAAGG - Intronic
1138750979 16:59420672-59420694 TAGTAAAAGCAGGTGGAAGAGGG - Intergenic
1138846023 16:60567608-60567630 TAGAACAAAAAGGTAGAGAAAGG + Intergenic
1138862790 16:60778365-60778387 TAGAAAAAGAATGTGGGAGATGG + Intergenic
1138923858 16:61566959-61566981 TAGAAAAAGCAGGTGGAAGAAGG - Intergenic
1138924913 16:61579898-61579920 TAGAACAAAAAGGTAAAGGAAGG - Intergenic
1138976990 16:62220119-62220141 TAGAACAAAAGTTTGGAGGAAGG - Intergenic
1138978939 16:62242751-62242773 TAGAACAAAAAGGCAAAGGAAGG - Intergenic
1139063280 16:63281825-63281847 TAGAGCAAAACAGTGGAGGACGG - Intergenic
1139296139 16:65902721-65902743 TAGAACAGAAAGGTGAAGAAGGG + Intergenic
1139688348 16:68621960-68621982 TAGAACAAAAAAGTCAAGGAAGG - Intergenic
1139747614 16:69087236-69087258 TAGAGCAAGGGGGTGGTGGATGG - Intergenic
1140016898 16:71196360-71196382 TAGAACAAAAAGTTGGAGGAAGG + Intronic
1140127591 16:72131158-72131180 TAGAAAAAGAAGTGGGAGGAAGG + Intronic
1140592444 16:76369883-76369905 TAGAACAAAACGGAGGAGAAAGG - Intronic
1140975998 16:80061045-80061067 TTGGACCACAAGGTGGAGGATGG - Intergenic
1141062540 16:80887344-80887366 TAGAACAAAATGGCAGAGGAAGG + Intergenic
1141294134 16:82751037-82751059 AAGATCAGGAAGGAGGAGGATGG - Intronic
1141775724 16:86121618-86121640 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1141781239 16:86162922-86162944 TAGAACAAAAAGGTGGAAGGAGG - Intergenic
1143532937 17:7516266-7516288 AAGAACAAAAAGGTAGAGGAAGG - Intergenic
1143727522 17:8859632-8859654 TAGGAGAAGAGGGAGGAGGAAGG + Intronic
1143980484 17:10865238-10865260 TGGCACAAGTAGGTGGAGAAGGG - Intergenic
1143983793 17:10893786-10893808 AAGAACAAAAAGGCAGAGGAAGG + Intergenic
1144346905 17:14357715-14357737 TAGAACCAAAAAGTGGAGGAAGG - Intergenic
1144347226 17:14360213-14360235 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
1145962213 17:28893397-28893419 AAAAAAAAGAAGGTGGAGGAAGG - Intronic
1146139117 17:30349551-30349573 TAGAACAAAAAGGTGGAGGGAGG - Intergenic
1146831464 17:36072981-36073003 TAGAACAAAAAGGCTGAGGAAGG + Intergenic
1147280678 17:39358201-39358223 TAAAACAAAAAGGTGGAGGAAGG - Intronic
1147431587 17:40374687-40374709 GAGGACAAAAAGGAGGAGGAGGG - Intergenic
1147498849 17:40942749-40942771 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1147537864 17:41332647-41332669 GAGAAGAGGGAGGTGGAGGAAGG + Intergenic
1147970263 17:44215643-44215665 GAGAAGAAGAAGGTGGGGGGAGG - Exonic
1147985745 17:44307043-44307065 AAGAGCAAGATGATGGAGGAGGG + Intergenic
1148693306 17:49545240-49545262 AACAACAAGCAGGTGGGGGAGGG + Intergenic
1148804295 17:50256555-50256577 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1148943634 17:51238545-51238567 TAGAAAAAGAAGATGGATGATGG + Intronic
1149373675 17:56022040-56022062 GAGAACAAAAAGGTGGAGAAAGG + Intergenic
1149399477 17:56280331-56280353 TAGAATAAAAAGGCAGAGGAAGG + Intronic
1149426522 17:56559822-56559844 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1149684657 17:58528426-58528448 TAGAACCAGCAGATGGAGGCTGG + Intronic
1150059464 17:62052686-62052708 TAGAAGAAGAAGATGGAGTGTGG - Exonic
1150342984 17:64383786-64383808 TAGAAAAACAAGATGGTGGACGG - Intronic
1150368921 17:64618810-64618832 TAGAAAAAGAAGGTAAAGGAAGG - Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150601223 17:66652827-66652849 TAGAGTAAGAGGGTGGAGGCAGG - Intronic
1150976464 17:70092855-70092877 TGGAACAAAATGGTGGAGGAAGG - Intronic
1151000386 17:70369123-70369145 TAGAAAGCAAAGGTGGAGGAAGG - Intergenic
1151160813 17:72164062-72164084 TAGGAAAAGAAGGGGCAGGATGG - Intergenic
1151329054 17:73396171-73396193 TCAAACAAGAAGGAGGAGGCTGG - Intronic
1151786350 17:76276897-76276919 TGGAGCGAGAAGGTGGAGGGAGG + Intronic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152036701 17:77877906-77877928 GAGAAAGAGAAGGTGGGGGAAGG + Intergenic
1152435508 17:80273914-80273936 AAGAAAAGGAAGGTGGAGGCCGG - Intronic
1152601926 17:81267400-81267422 TAAAAGAAGAAGGAGGGGGAGGG - Intronic
1152731241 17:81971837-81971859 TAGAACAAAAAGGTGGAAGAAGG + Intergenic
1152731672 17:81975103-81975125 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1152863805 17:82710517-82710539 GAGGACAAGAAGGAGGTGGACGG + Intergenic
1153365092 18:4247072-4247094 TAGGACAAGGAGGAGAAGGAAGG + Intronic
1153449392 18:5209910-5209932 TAAAACAAAAAGGCAGAGGAAGG - Intergenic
1153567211 18:6430462-6430484 AAGATCAAGAGGGTGGAGGGAGG - Intergenic
1154236361 18:12609909-12609931 TGGAGCAAAAAGGTGGAGGGGGG - Intronic
1154291387 18:13110925-13110947 TAGAAGAGGCAGGTGGAAGAAGG - Intronic
1154491849 18:14928465-14928487 AAGAACAAAGTGGTGGAGGAAGG + Intergenic
1154946032 18:21162120-21162142 TAGAACAAAATTGTGGTGGAAGG - Intergenic
1155106647 18:22673447-22673469 TAGGACAAAAGGCTGGAGGAAGG - Intergenic
1155119668 18:22805454-22805476 TAGATCAAGAAGGTGGAAGAAGG - Intronic
1155678460 18:28459412-28459434 TGGAACAAAAAGGTGCAGGAAGG - Intergenic
1155848361 18:30737399-30737421 TAGAACAAAAAGGCTGAGGAAGG - Intergenic
1156296827 18:35799796-35799818 TAGAACAAAAAGGTGGAGTAAGG + Intergenic
1156629514 18:38949977-38949999 TAGAACAAAAAGGTAGAGGAAGG - Intergenic
1156829763 18:41477784-41477806 AAGAAGAAGAAAGTGGAAGAGGG + Intergenic
1157510819 18:48272255-48272277 TAGGACAAAAGGGTGCAGGAAGG + Intronic
1157540707 18:48503755-48503777 TAAAACAAAAAGGCAGAGGAAGG - Intergenic
1157768665 18:50325138-50325160 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1157829772 18:50846574-50846596 TAGAACAAAAAGTCAGAGGAAGG - Intergenic
1158141535 18:54261167-54261189 TAGAACAAAAAGGTTGAGTTAGG + Intergenic
1158175863 18:54654990-54655012 TAGAAAAAGCAGGCGGAAGAAGG - Intergenic
1158349324 18:56549125-56549147 TAGGAGAAGCGGGTGGAGGATGG + Intergenic
1158374889 18:56851827-56851849 ATGAGCAAGAAGGTGGGGGAAGG - Intronic
1158554411 18:58463588-58463610 TAGAACAAAAAGGTAGAAGAAGG - Intergenic
1158555808 18:58473846-58473868 AAAAAAAAAAAGGTGGAGGAAGG - Intergenic
1158941922 18:62412496-62412518 TAGAAGAGGGAGGTGGAGGCTGG - Intergenic
1159053395 18:63442559-63442581 TAAAGGAAGAAGGAGGAGGAGGG + Intergenic
1159122940 18:64191402-64191424 AACAACAGGAAGGTGGGGGAGGG - Intergenic
1159271240 18:66153814-66153836 AAGACGAAGAAGGAGGAGGAGGG + Intergenic
1159611440 18:70530261-70530283 TAGAACAATGAGGCAGAGGAAGG - Intergenic
1159678817 18:71321146-71321168 TAAAACAAAAAGGGAGAGGAGGG - Intergenic
1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG + Intergenic
1159783318 18:72684528-72684550 TAGAACAAAAAAGTGGAGTATGG - Intergenic
1159817567 18:73094731-73094753 CAGAACAAAAAGGTGAAAGAAGG + Intergenic
1159903810 18:74072392-74072414 GAGGACAGGAGGGTGGAGGACGG + Intergenic
1160077773 18:75694270-75694292 CAGAACAGGAATGTGGAGCATGG + Intergenic
1160151282 18:76396177-76396199 AAGAAGAAGAAAGTGAAGGAGGG - Intronic
1160167507 18:76527358-76527380 TGGGACAACATGGTGGAGGAAGG + Intergenic
1160346501 18:78136680-78136702 TAGAGCAAGAAGGCAGTGGAAGG + Intergenic
1160925361 19:1542280-1542302 AAGAAAAAGAAGGAGAAGGAAGG - Intergenic
1160973930 19:1783251-1783273 CAGGAGGAGAAGGTGGAGGAGGG - Exonic
1161227806 19:3155293-3155315 GAGAACAGGAAGGTGGGGGCAGG + Intronic
1161404042 19:4081925-4081947 AGGAGCAAGAAGGAGGAGGAGGG - Intergenic
1161431817 19:4236886-4236908 TAGAACCAGAAGATGGAGAGGGG - Intronic
1161520983 19:4723471-4723493 GAGGGAAAGAAGGTGGAGGAGGG + Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161860196 19:6792214-6792236 TGGAAAAAGAAGGTTGATGAAGG + Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162867748 19:13561673-13561695 TAGAACAAAAAAGTGGAGGAAGG + Intronic
1162994378 19:14324726-14324748 TAGAACCAAAAGGCAGAGGAAGG - Intergenic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163465805 19:17467991-17468013 GAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1164149817 19:22541394-22541416 AAGAAGAGGAGGGTGGAGGAGGG - Intergenic
1164515558 19:28932459-28932481 TAGAACCAGGAGATGGAGGGGGG - Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1164644728 19:29850062-29850084 TAGAACAAAAATGCAGAGGAAGG + Intergenic
1164779029 19:30877868-30877890 GAGAACAGAAAGTTGGAGGAGGG + Intergenic
1164808441 19:31137334-31137356 TAGAACAAAAAGGTGGAGGACGG + Intergenic
1164858638 19:31544969-31544991 GAGAAAGAGAAGGAGGAGGAGGG - Intergenic
1165441948 19:35833525-35833547 AAGAAGATGGAGGTGGAGGAGGG + Intronic
1165454578 19:35903321-35903343 AAGAGAAAGAAGGTGGATGAGGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167286578 19:48601804-48601826 TGGAAGGAGATGGTGGAGGAGGG + Intronic
1168643451 19:58044974-58044996 AAGAACAAGAAGCTGGAGGAAGG + Intronic
1168709889 19:58493221-58493243 TAGAAGTAAAAGGTGGTGGAGGG - Intronic
1202697537 1_KI270712v1_random:135847-135869 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
925025720 2:605851-605873 TAGAAGGAAAAGGAGGAGGATGG + Intergenic
925378645 2:3407810-3407832 AAGAAAAAGAAAATGGAGGAGGG + Intronic
925489755 2:4377942-4377964 TAGAACAAGAAGGCCATGGATGG - Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925553457 2:5101991-5102013 TAGAAGGAGAAGGGGGAGGAGGG + Intergenic
925579939 2:5400189-5400211 TAGAAAAAAAAGGTGGAGGAAGG - Intergenic
925641378 2:5988827-5988849 TAGAACAAAAAGGTAGAGGATGG - Intergenic
925676688 2:6369330-6369352 TAGAACAAAAATGTAAAGGAAGG + Intergenic
925773435 2:7307285-7307307 TAGAACACAAAGAAGGAGGAAGG + Intergenic
925848141 2:8052272-8052294 TAGAACAAAAAGGTGGCAGAAGG - Intergenic
925906165 2:8540705-8540727 GGGAACAAGGAGGTTGAGGAAGG + Intergenic
925932243 2:8717775-8717797 TAGGACAAAAAGGTGGAGGAAGG + Intergenic
925960214 2:9006854-9006876 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
925961521 2:9021638-9021660 TAGAAGAAAAAGGCAGAGGAAGG - Intergenic
926402610 2:12513576-12513598 CAGAACAAAAAGGCAGAGGAAGG + Intergenic
926872739 2:17441156-17441178 AAGACCCAGAAGGTGGAGGCAGG + Intergenic
926985083 2:18613652-18613674 TAGACCAAAAAGGGGGAGGAAGG + Intergenic
927023706 2:19043712-19043734 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
927028581 2:19096406-19096428 AGGAAGAAGAAGGTGGAAGAAGG + Intergenic
927036183 2:19179067-19179089 TAGAATGAGCAGGTGGAGCAAGG - Intergenic
927291428 2:21408540-21408562 TTGAAGATGAGGGTGGAGGAAGG + Intergenic
927308865 2:21605514-21605536 TAGAACAAAAAGGCAGGGGAAGG - Intergenic
927449574 2:23195927-23195949 TAGAAGAACAAAGTGTAGGAAGG + Intergenic
927488384 2:23504662-23504684 CAGAAAAAGAAGCTGGAGCAAGG + Intronic
927866752 2:26593069-26593091 ACGAACAAAAAGGTGGGGGAAGG + Intronic
928145357 2:28769722-28769744 TAGAACAAAAGGCTGGAGGCGGG + Intronic
928298463 2:30105687-30105709 TGGAAAAGGAAGGTGGATGATGG - Intergenic
928319530 2:30272024-30272046 CGGAACAAAAAGGTGGAAGAAGG + Intronic
928323917 2:30304908-30304930 TAGAACAAAAAGGCAGAGAAGGG + Intronic
928673952 2:33632053-33632075 GAGAAGGAGAAGGTGAAGGAGGG - Intergenic
928858869 2:35831682-35831704 TAGAACAAAAATGTAGAGAAAGG - Intergenic
928870115 2:35965880-35965902 TAAAACAAAAAGGTAGAGGAGGG + Intergenic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929017984 2:37520443-37520465 TAGAACCAAAAGGTGGAGGAAGG + Intergenic
929411555 2:41702611-41702633 GTGAAGAAGAAGGTGGAGGTTGG - Intergenic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930272604 2:49274367-49274389 TAGAACAAAAAGGTGGAGAAAGG + Intergenic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930533568 2:52619867-52619889 TAGAACAAAAAGGCAGAAGAAGG + Intergenic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
931092559 2:58901442-58901464 TGGTGGAAGAAGGTGGAGGAAGG + Intergenic
931173233 2:59827212-59827234 TAGAACAACATGATGGAGTAGGG - Intergenic
931195968 2:60052628-60052650 TAGAACAATAGGGTGCAGGAAGG - Intergenic
931334234 2:61322568-61322590 TAGAACCAGAAGGGGCATGATGG + Intronic
931439074 2:62274605-62274627 TAGAATGAAAAGGCGGAGGAAGG - Intergenic
931476569 2:62593887-62593909 TAGAACAAAAATGTGGAGGAAGG + Intergenic
932289736 2:70566730-70566752 TAGAATTAAAAGGTGGAGGAAGG + Intergenic
932301190 2:70668012-70668034 TAGAACAAAAAGGTGGAGGAAGG + Intronic
933084453 2:78038171-78038193 TAGAACAAAAAGGGTGAAGAAGG - Intergenic
933104836 2:78311305-78311327 TAGAATAAAAAGGTGGAAAAAGG + Intergenic
933195235 2:79382109-79382131 TAGAACAAAAAGGTGGAAGAAGG + Intronic
933200573 2:79443389-79443411 CAGAAAAAAAAAGTGGAGGAAGG - Intronic
933236645 2:79871556-79871578 CAGAACAAAAAGGTGGAGGAAGG - Intronic
934278709 2:91592871-91592893 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
934652317 2:96099737-96099759 GAGAAGGAGGAGGTGGAGGAAGG + Intergenic
934965747 2:98720344-98720366 TAGATCAAAAAGGTGGAGGAAGG + Intronic
935150817 2:100433560-100433582 AAGAACAAAAATGTGGAGGAAGG + Intergenic
935178502 2:100670245-100670267 TAGAACAAAAAAGCAGAGGAAGG - Intergenic
935485238 2:103645263-103645285 TAGAACAAAAAGGCGGAAGGAGG + Intergenic
935511678 2:103983847-103983869 TAAAGCAAAAAGGTGAAGGAAGG + Intergenic
935738823 2:106128530-106128552 TAGAACACAAAGATGGAGGAAGG + Intronic
936580820 2:113699011-113699033 TAAAACAAGAAGGCAGAGGAAGG - Intergenic
936659951 2:114531994-114532016 TAGAACAAAGAGGCTGAGGAAGG + Intronic
936849755 2:116881648-116881670 TAGAACAAAAAGGTGAAGGAAGG - Intergenic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937453908 2:122025122-122025144 AAGGAGAAGAAGGTGGAAGATGG + Intergenic
937454143 2:122026755-122026777 TAGAGCAAGAAGGTGGAGGAAGG - Intergenic
937475072 2:122208106-122208128 GAGAACAAGAGGGTGGGTGAGGG + Intergenic
937579086 2:123461538-123461560 GAAAAGAAGAAGGAGGAGGAGGG - Intergenic
937774095 2:125755392-125755414 TAGAACACAAAGGCAGAGGAAGG - Intergenic
937828432 2:126393091-126393113 AAGAATAAAAAGGTGTAGGAAGG + Intergenic
937937040 2:127254452-127254474 CAGAACAAAAGGATGGAGGAAGG - Intergenic
937958525 2:127437640-127437662 AAGGAAAAGAAGGTGCAGGAGGG - Intronic
938004086 2:127773411-127773433 AATAACAACAAGGAGGAGGAGGG + Intronic
938070108 2:128303942-128303964 CAGAACAGGAAGGTGGAGGAAGG + Intronic
938195436 2:129323419-129323441 TAGAACAAAAAGGAGGAAGAAGG - Intergenic
938197003 2:129337257-129337279 TTTAACCAGCAGGTGGAGGATGG - Intergenic
938225753 2:129614714-129614736 AAGAACAGGAAGGAGGAGGGGGG + Intergenic
938301968 2:130221755-130221777 TAGAACAAGAAGGTGGAGGAAGG + Intergenic
938454733 2:131452697-131452719 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
938512842 2:131969000-131969022 CAGAACAAAAAGGCAGAGGAAGG - Intergenic
938594703 2:132776329-132776351 TAGAGAAAGGAGGTGGAGAAGGG - Intronic
939007250 2:136803896-136803918 TAGAACAAAAAGGCAGAGGAAGG - Intronic
939094691 2:137821226-137821248 AACAGCAAAAAGGTGGAGGAGGG + Intergenic
939204377 2:139081169-139081191 TAGAACAAAAAGGTAGAGGAAGG - Intergenic
939209243 2:139150892-139150914 TAGAACAAAAAGATCGATGAAGG - Intergenic
939234473 2:139473449-139473471 TAGAACAAGAAAGGGGAATATGG - Intergenic
939239803 2:139543037-139543059 TAGAACATGAGGGTGGAGAGAGG + Intergenic
939280071 2:140052541-140052563 GAGAAGAAGAAAGAGGAGGAAGG + Intergenic
939675112 2:145062795-145062817 TAGAACAAAAAAGTGGAGACAGG - Intergenic
939683311 2:145166498-145166520 TAGAAAGAGGAGGTGGAGGGGGG - Intergenic
939753057 2:146072823-146072845 GAATAGAAGAAGGTGGAGGAAGG + Intergenic
939950692 2:148468957-148468979 GAGCACAAGAAGGTGGAGGAGGG - Exonic
940002428 2:148979718-148979740 CAAAACTAGAAGGTAGAGGAGGG + Intronic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940305428 2:152220934-152220956 TGGAACACAACGGTGGAGGAAGG - Intergenic
941167744 2:162101652-162101674 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
941532248 2:166685029-166685051 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
941620103 2:167768035-167768057 TAGAACAAAAAGGCAGGGGAAGG - Intergenic
941863617 2:170310718-170310740 TACAACTTGAAGGTGGGGGATGG + Intronic
941947795 2:171119354-171119376 GAGAACAAGAAGGTGGTGGGGGG - Intronic
942270173 2:174266498-174266520 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
942309505 2:174642332-174642354 AAAAAAAAAAAGGTGGAGGAAGG - Intronic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942497159 2:176551880-176551902 TAGAAGAAAAAGATGGAGGAAGG + Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943577137 2:189643075-189643097 TAGAAAAAAAAGGAGAAGGAGGG - Intergenic
943600901 2:189919855-189919877 TAGAGGAAGAGGATGGAGGAGGG - Intronic
943735270 2:191347146-191347168 TAAAAGAAGAAGGTGGAGAAAGG - Intronic
943816373 2:192262451-192262473 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
943827786 2:192417540-192417562 TAGAACAAAAAGGCAGAAGAAGG + Intergenic
944344059 2:198639246-198639268 TAGAACAAAAAGGTGGGAAATGG + Intergenic
944403240 2:199352687-199352709 CAGAAGAACTAGGTGGAGGAGGG + Intronic
944663463 2:201940045-201940067 CAGCACAAGAAAGTTGAGGAAGG + Intergenic
944674515 2:202023913-202023935 TAGAATAATAAGGGGGAGGCAGG + Intergenic
944818200 2:203401275-203401297 GAGGAGATGAAGGTGGAGGAGGG - Intronic
944931429 2:204524188-204524210 TAGAACAAAAAGGTGAAGGAAGG - Intergenic
945138831 2:206661535-206661557 GAGAAGAAGAGGGAGGAGGAGGG - Intronic
945457568 2:210067013-210067035 TAAAACAAAAAGGCAGAGGAAGG + Intronic
945539126 2:211061735-211061757 TAGAACAATATGGTGGGGGAAGG - Intergenic
945701555 2:213176960-213176982 TAGAACAATAAGGCAGAGGAAGG - Intergenic
946069732 2:217023678-217023700 TAGAACAAAAAGATGAAGGAAGG - Intergenic
946704724 2:222446998-222447020 TAGAACAAGAGGTTAGAGGCTGG + Intronic
946725764 2:222659835-222659857 GAGAATAAAAAGGGGGAGGAAGG - Intergenic
946883802 2:224202816-224202838 TACAACAGGTAGGAGGAGGAGGG + Intergenic
946917481 2:224540048-224540070 AAAAAAAAAAAGGTGGAGGATGG - Intronic
947080066 2:226386143-226386165 TAGAACAAGAAGTTTGGGGGTGG - Intergenic
947248064 2:228072066-228072088 TAGAATAAAAAAGTGGAGGAAGG + Intronic
947936092 2:234005169-234005191 GGGGACCAGAAGGTGGAGGAGGG - Intronic
947937763 2:234022723-234022745 TGGAACAAAAGGGTTGAGGAAGG - Intergenic
947999216 2:234553903-234553925 TGGAACAAAAAGGCAGAGGAAGG + Intergenic
948136159 2:235637919-235637941 GAGGGCAAAAAGGTGGAGGAAGG - Intronic
948271062 2:236673653-236673675 TAGAACAATGAGGTGGACGCCGG + Intergenic
948309821 2:236976763-236976785 GAGAACAAGGAGGAGGGGGAAGG - Intergenic
948533314 2:238627647-238627669 TAGAATAAAATAGTGGAGGAAGG + Intergenic
948655092 2:239471601-239471623 TAGAACAAAAAGGCAGAGAAGGG - Intergenic
948883598 2:240872379-240872401 GTGAACATGCAGGTGGAGGAGGG + Intronic
1168866739 20:1093001-1093023 TAGGGCAGGAAGGTGGAGGAAGG + Intergenic
1168888592 20:1278358-1278380 TAAAGCTAGAAGGAGGAGGATGG - Intronic
1169329910 20:4708230-4708252 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1169417853 20:5432967-5432989 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1169830202 20:9816527-9816549 TGGAACAAAAAGGCAGAGGAAGG + Intronic
1170209970 20:13838557-13838579 AAGAAAAGGAAGGTGGAGAAGGG - Intergenic
1170291236 20:14771104-14771126 TAGAACAAAAATGTAGAGGAAGG + Intronic
1171006939 20:21475594-21475616 TAGAACAAAAATATGGAGAAGGG - Intergenic
1171078286 20:22151459-22151481 CAGAACAAAAAGATGGAGGAAGG - Intergenic
1171161770 20:22931935-22931957 TAGAACAAAAAGGCCGGGGAAGG - Intergenic
1171212902 20:23330365-23330387 TAAAACAAAAAGGCAGAGGAAGG + Intergenic
1171774538 20:29352986-29353008 GAGAGAAAGAAGGTAGAGGAAGG - Intergenic
1173324641 20:42021519-42021541 TAGAACAAAAAGGCAGAGAAGGG + Intergenic
1173395963 20:42679969-42679991 TAGAACAAGGAAGAGGAGAAAGG + Intronic
1173398521 20:42703184-42703206 GAGAATAAGAATGTGGAGAAAGG + Intronic
1173452795 20:43180089-43180111 CAGAACAAAAAGGTAGAGAAGGG + Intronic
1174164491 20:48575271-48575293 TAGAACAAAAAGGCAGAGGAGGG + Intergenic
1174539980 20:51281581-51281603 TAGAACAAAAAGGCAGAGAAAGG + Intergenic
1174956120 20:55100443-55100465 TAGAAAAAGCAGGCAGAGGAAGG - Intergenic
1175100631 20:56576269-56576291 TAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1175177268 20:57119768-57119790 TAGAACAAAAAACTGGAGAATGG + Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175528286 20:59652146-59652168 TAGAACAAAAAGGTAGATAAAGG - Intronic
1175665230 20:60852946-60852968 TAGGCCAAGAAGAGGGAGGAGGG + Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176734190 21:10527879-10527901 AAGAGCATGAAGGTGGTGGAGGG + Intronic
1176780934 21:13193834-13193856 CAGAACAAAAAGGCAGAGGAAGG + Intergenic
1176918982 21:14663630-14663652 AAGGACCAGAAGGAGGAGGAAGG + Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177240822 21:18454710-18454732 TAGCACAAAAAGGCAGAGGAAGG - Intronic
1177357450 21:20027927-20027949 TAGAAGAAGACGATGGAGAAAGG + Intergenic
1177357622 21:20030315-20030337 TAGAAGAAGAAGATGGAGAAAGG + Intergenic
1177390886 21:20470301-20470323 TAGAACAAAGAGGCAGAGGAAGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177644234 21:23881699-23881721 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1177655715 21:24013920-24013942 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1177798747 21:25806706-25806728 TAGAATAAAAAGGTGGAGGAAGG + Intergenic
1177867780 21:26533509-26533531 TAGAACAAAAAGGCAGAGGAGGG - Intronic
1177868518 21:26542217-26542239 CAGCATAAGAAGGTGGGGGACGG + Intronic
1177914738 21:27074900-27074922 TAAAACAAAAAGGCAGAGGAGGG - Intergenic
1177923339 21:27182610-27182632 CAGAACAAAAAGGTGGAGGGAGG - Intergenic
1177978615 21:27882947-27882969 CAGAACAAAAAGGCAGAGGAAGG + Intergenic
1178046738 21:28703321-28703343 TAAAAAAAAAAGGTGGGGGAAGG + Intergenic
1178386200 21:32152436-32152458 TAAAACAAAAAGGGGGAGGAAGG - Intergenic
1178399672 21:32274494-32274516 TAGAAAAAGAAGGTCGGGCACGG - Intronic
1178536575 21:33414852-33414874 GAGAAAAAGAAGAGGGAGGAAGG - Intronic
1178979041 21:37245441-37245463 AAGAACAAGCAGGTGGAGCAAGG - Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179076629 21:38128364-38128386 TAGACCAAAAAAGTGGAGGGAGG - Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179335511 21:40448290-40448312 TAGAACAAAAACATAGAGGAAGG + Intronic
1179376867 21:40857465-40857487 TAGAACAAAAAGAAGAAGGAAGG - Intergenic
1179457734 21:41510713-41510735 TAGAACAGAAAAGGGGAGGAAGG - Intronic
1179626168 21:42650746-42650768 GAGAACAAGAAGGCAGAGGAAGG + Intergenic
1180561931 22:16623363-16623385 AAGAGCATAAAGGTGGAGGAGGG + Intergenic
1180592941 22:16956215-16956237 GTGAACAAGAAGGGGGAGAATGG + Intergenic
1180622180 22:17169476-17169498 TAGGACAAAAAGGCAGAGGAAGG + Intergenic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1180898129 22:19352184-19352206 TAGAACAGGCAGGTGGAAGATGG + Intronic
1181084529 22:20433388-20433410 TAGAACCGGAAGGTGGTGGGGGG + Intronic
1181654491 22:24284987-24285009 TTGAAGAGGAAGATGGAGGAAGG + Intronic
1181839807 22:25647139-25647161 GAGGACGAGGAGGTGGAGGAAGG + Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182029051 22:27143265-27143287 GAGATCAAGATGGTAGAGGAAGG + Intergenic
1182062886 22:27410516-27410538 TGGACCAAGGAGCTGGAGGAGGG + Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182941188 22:34279389-34279411 TAGAACAAAAAGGTAGAGGAAGG - Intergenic
1183016800 22:34995222-34995244 TAGAACAAAAAGGCAGGGGAAGG - Intergenic
1183032275 22:35115168-35115190 TAGAAAAGGAAGGTGGTGGCTGG + Intergenic
1183392314 22:37552523-37552545 GAGAGCAAGAAGTTGGAGGGGGG - Intergenic
1183868086 22:40720119-40720141 TAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1184269939 22:43374332-43374354 TAGAACAGAAAGGTGGAGGAAGG - Intergenic
1184514829 22:44955553-44955575 TAGAACAAAAAGGCGGGGAAGGG + Intronic
1184555917 22:45233040-45233062 CAGATCAGGAAGGTGGAGGAAGG + Intronic
1184932522 22:47691815-47691837 TAGAACAAGGAGGCAGAGAAAGG + Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185111699 22:48903696-48903718 TAGAACACAAAGGTAGAGGCAGG + Intergenic
949100064 3:132892-132914 TGGAACAAAAAGGTAGAGGAAGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949400861 3:3664185-3664207 AAGAACAAAAAGGTAGAGAAAGG - Intergenic
949454655 3:4225924-4225946 TAAAACAGGAAGATGTAGGATGG + Intronic
949618321 3:5781380-5781402 TAGAACAAAAAGATTAAGGAAGG - Intergenic
949686482 3:6577894-6577916 TAGAACAAAAGGGTAGAAGAAGG + Intergenic
949759529 3:7453922-7453944 ATTAACAAAAAGGTGGAGGAAGG + Intronic
950002924 3:9671142-9671164 GAGAACAAGAAGGTGAAGTTTGG + Exonic
950288372 3:11763135-11763157 AAAAACAAAAAGGTGGAGGATGG - Intergenic
950327785 3:12128638-12128660 TAGAACATTAAGGTGGAAGATGG + Intronic
950358222 3:12429569-12429591 AAAAAGAAGCAGGTGGAGGAAGG + Intronic
950401749 3:12774333-12774355 CAGAACCAAAAGGTGGAGGAAGG - Intergenic
950755811 3:15171595-15171617 TGGTACAAGAAGGTGAAGGAAGG - Intergenic
950839424 3:15952565-15952587 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
951036564 3:17939165-17939187 TAGAAGTAGAAGCTGGTGGAAGG + Intronic
951246812 3:20350571-20350593 TAGAACAAAAGGGCAGAGGAAGG + Intergenic
951391146 3:22105691-22105713 TAGAACAAAAAGGTGGAGGAAGG - Intronic
951420568 3:22479415-22479437 TAAAACAAAAAGGTAGATGAAGG + Intergenic
951986661 3:28628651-28628673 TAAAATAAAAAGGCGGAGGAAGG + Intergenic
952077297 3:29712701-29712723 TAGAACAAAAAGGTGGAGAAAGG + Intronic
952138113 3:30446533-30446555 TAGAGCAAGAATGTGGAGCCTGG - Intergenic
952214153 3:31259441-31259463 AAGAACAAAAAGGCAGAGGAAGG - Intergenic
952733913 3:36669007-36669029 TAGGACAAAAAGGCAGAGGAAGG - Intergenic
952863862 3:37838119-37838141 GAGAAATAGAGGGTGGAGGATGG + Intergenic
952962696 3:38602714-38602736 TTGACCAGGAAGGTGGAGGATGG - Intronic
953007990 3:38995553-38995575 TAGAACAGAAAGGAAGAGGAAGG + Intergenic
953133560 3:40163550-40163572 TAGAACAAAAAGGCAGAGGAAGG + Intronic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953237549 3:41119690-41119712 TAAACCAACAAGGAGGAGGAAGG - Intergenic
953238757 3:41128981-41129003 TAGAACACAAAGGTGAACGAAGG - Intergenic
953260973 3:41338914-41338936 TAGAACAAAAAGGTGGGAGAAGG - Intronic
953294616 3:41701973-41701995 TAAAACAAGAAAGTGGAAGTAGG + Intronic
953410173 3:42686426-42686448 AAGAAAAAGAAGGGGAAGGATGG + Exonic
953457197 3:43052756-43052778 TAGGACAAAGAGGTTGAGGATGG - Intronic
953843111 3:46405861-46405883 AAAAAGAAGAAGGAGGAGGAGGG - Intergenic
953895734 3:46798692-46798714 CAGAACAAAAATGTGGAGGAAGG + Intronic
954824904 3:53364208-53364230 TAGAAAAAGAAGTTAGAAGAGGG + Intergenic
954984613 3:54778565-54778587 TAGTACAAGAAGTTCTAGGATGG - Intronic
955497960 3:59556134-59556156 CAGAACAGGAAGCTGGAAGAAGG - Intergenic
955576091 3:60364808-60364830 AAGAACAAAAAGGTAGAGGAAGG + Intronic
955715006 3:61820326-61820348 TAGAACAAAAAGGCAGAGGAAGG - Intronic
955900226 3:63745748-63745770 AATAACAAGAAAGTAGAGGAAGG + Intergenic
956000497 3:64724886-64724908 TAGAACAAAAAGGTGCAGGAAGG + Intergenic
956097892 3:65736691-65736713 TAGAACACAAATATGGAGGAAGG - Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956565889 3:70638263-70638285 TAGAATAAAAAGGCAGAGGAAGG - Intergenic
956992523 3:74783791-74783813 TAGAACAAAAAGATAGAAGAAGG - Intergenic
957307668 3:78479284-78479306 AAGAAAAATAAGGTGGAGGCAGG - Intergenic
957442912 3:80274665-80274687 TAGAACAAAAAGGTGGAGAAAGG + Intergenic
957582535 3:82092961-82092983 AAGTACTAGAAGGAGGAGGAAGG - Intergenic
958145656 3:89621350-89621372 TAGAACAAAAAAGTGGAGGAAGG - Intergenic
958185297 3:90111928-90111950 TAGAACAAAAAGTGGGAAGAAGG + Intergenic
958482043 3:94654772-94654794 TAGAACAAAAAGGTGGATGAGGG + Intergenic
958636858 3:96755850-96755872 TAGAACAAGGAGTTGGGGTAGGG + Intergenic
958964166 3:100539700-100539722 TAGAACAAAAAGGTAGAATAAGG - Intronic
959015573 3:101130309-101130331 TAGAACAAACAGGCAGAGGAAGG + Intergenic
959221681 3:103529507-103529529 TAGAACAAAAAGGGGGAGGAAGG - Intergenic
959245982 3:103868602-103868624 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
959264898 3:104124761-104124783 TAAAACAAGATGGTGTAGTACGG + Intergenic
959465155 3:106677072-106677094 TAGAATAAAAAGGTAGAAGAAGG - Intergenic
959577536 3:107950445-107950467 TAGAACAAAAAGGTAGAGGAAGG + Intergenic
959683436 3:109121714-109121736 TGGAACAAAAAGATAGAGGAAGG + Intergenic
959830872 3:110860972-110860994 TATAACAATAAAATGGAGGAGGG - Intergenic
960092904 3:113659878-113659900 CAGAACCAGGAGGTGGAGCAGGG + Exonic
960137225 3:114118155-114118177 TAGAACAAAAAGGCAGAAGAAGG + Intergenic
960418603 3:117415600-117415622 GGGAAGAAGAAGGGGGAGGAAGG - Intergenic
960441325 3:117692604-117692626 CAGAACAAAAAGGCTGAGGAAGG + Intergenic
960502673 3:118455739-118455761 GATAACAACAAGGTGGGGGAGGG - Intergenic
961008153 3:123418822-123418844 TAGAGCAAAAAGGTAGAGGAGGG + Intronic
961581623 3:127887979-127888001 TAGGACAAAAAGGCAGAGGAAGG - Intergenic
961596995 3:128025663-128025685 TTGAACCAGGAGGTGGAGGTTGG + Intergenic
961638331 3:128349071-128349093 GGAAACAGGAAGGTGGAGGAGGG + Intronic
961957523 3:130819280-130819302 TATAATAAGAAGTTGGAGGAAGG - Intergenic
962215098 3:133514301-133514323 TAGAAAAAAAAGGCAGAGGAAGG + Intergenic
962338253 3:134557897-134557919 AATTCCAAGAAGGTGGAGGAAGG - Intronic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963075687 3:141344348-141344370 TAGAAGAAGAAGATGGAGGAAGG - Intronic
963226329 3:142866232-142866254 TAGAACAAAAAGGTGGAGGAAGG + Intronic
963391593 3:144671694-144671716 TAGAACAAAAAGGCAGAAGAAGG - Intergenic
964334671 3:155642600-155642622 TAGAACAAAAAGGCAGAGGAAGG + Intronic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964409053 3:156379395-156379417 TAGAAAAGGAAGGTGGATGAGGG + Intronic
964419253 3:156484143-156484165 AAGAAAAAAAAGGTGGGGGAGGG - Intronic
964434922 3:156641378-156641400 TGGATCAAGCAAGTGGAGGATGG - Intergenic
964508913 3:157427943-157427965 TAGAACAAAAAGGTGGAGGAAGG + Intronic
964564344 3:158033209-158033231 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
964653733 3:159043196-159043218 TAGAACAAATATGTGGAGGAAGG - Intronic
964706517 3:159624521-159624543 GAGAACAAGAAGCTAGAAGATGG + Intronic
965097110 3:164244453-164244475 TATAACAAAAAGGTGGAGGGAGG - Intergenic
965190274 3:165519037-165519059 TAGAGGAAGAAGGTGAAGCAAGG - Intergenic
965232270 3:166070007-166070029 TAGAAATAGAAGGTAGAGGCTGG + Intergenic
965622262 3:170653778-170653800 AAGAAGAAGAAGGAGGAGAAGGG - Intronic
965991569 3:174825432-174825454 TAGAACAAAAAGGCAGAGAAAGG - Intronic
966661697 3:182421703-182421725 TAGAACAAAAAGGTGGAGAAAGG + Intergenic
966802913 3:183781388-183781410 TAGAACAAAAAGGCGGACAATGG - Intronic
966888649 3:184390403-184390425 TAGACAAAGAAGGTAGAGGCTGG - Intronic
966897241 3:184454794-184454816 TAAAACAAAAAGGTGGAGGAAGG - Intronic
967213337 3:187188297-187188319 TAGAACAAAATGGCAGAGGAAGG + Intergenic
967523347 3:190462235-190462257 TAGAACAAAAAGTTGGAGAAAGG - Intergenic
967612842 3:191528244-191528266 TAGAACAGAAAGATGGAGGAAGG + Intergenic
967662766 3:192133292-192133314 TAGGACAGAAAAGTGGAGGAAGG - Intergenic
967734103 3:192934003-192934025 TGGTTAAAGAAGGTGGAGGAAGG - Intergenic
967760214 3:193215551-193215573 TAGAAAAGGCAGGTGGAAGAAGG - Intergenic
967760348 3:193217280-193217302 TAGAAAAAGCAGGTAGAAGAAGG - Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968029892 3:195474791-195474813 GAGAAAGAGAAGGTGGGGGAGGG + Intergenic
968223066 3:196952819-196952841 TAAAACAGAAAGGTGGAGGAAGG + Intronic
968360962 3:198146526-198146548 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
968669522 4:1841531-1841553 AAGAACAAGAAGCTGGAGGAAGG - Exonic
968748661 4:2374636-2374658 GAGAAGGAGAAGGAGGAGGAGGG + Intronic
969929375 4:10615104-10615126 TGGACCCAGAAGGTGGAGGTCGG + Intronic
969948062 4:10805227-10805249 CAGAACAGAAAGGTGGAGGAAGG + Intergenic
969965453 4:10989626-10989648 TAGAACCAAAAGGTGGATGTAGG + Intergenic
970052755 4:11933753-11933775 TAGAACAAATAGGTGGAGGAGGG + Intergenic
970072840 4:12181692-12181714 CAGAGCAAAAAGGTAGAGGAGGG + Intergenic
970135246 4:12914919-12914941 TAGAACAACAAGGTGCAGGAAGG - Intergenic
970291687 4:14579678-14579700 TAGAACAAAAAGATAAAGGAAGG - Intergenic
970307282 4:14746583-14746605 AAGAACAAAAAGGCAGAGGAAGG + Intergenic
970477197 4:16435671-16435693 TAGAACTAAAAGGTGGAAGAAGG - Intergenic
970486093 4:16526208-16526230 TAGAACAAAAAGGCAGAGAAAGG + Intronic
970566808 4:17339684-17339706 TAGAACAAAAAGGTAGAGGAAGG - Intergenic
970606291 4:17685248-17685270 TAGATTAAGAAGGCTGAGGAGGG + Intronic
970625107 4:17868653-17868675 TAGATCCAGGGGGTGGAGGATGG - Intronic
970639819 4:18051542-18051564 TAGAACAAAAAGGTAGAGGAAGG + Intergenic
970642670 4:18084724-18084746 CTGAACAAGAATGTGGAGGTGGG + Intergenic
970647378 4:18138115-18138137 TAGAAAAAGCAGGCGGAAGAAGG + Intergenic
970908275 4:21242604-21242626 TAGAACAAAAAGGTAGAGAAAGG + Intronic
970955742 4:21809217-21809239 TAGGACAAAAAGGTGGAGGAAGG + Intronic
971336714 4:25729944-25729966 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
971380787 4:26095654-26095676 AGGAAGAAGAAGGAGGAGGAAGG + Intergenic
971439173 4:26661320-26661342 AGGAAAAAGAAGGTGGAGGGTGG - Intronic
971590376 4:28460241-28460263 TACAACAAAAAGGTGAAGAAAGG + Intergenic
971629712 4:28974731-28974753 CAGAAGAAAAAGGTGAAGGAAGG - Intergenic
971693675 4:29870380-29870402 TAGAACAAAAAAGTAGAGGAAGG - Intergenic
971733728 4:30418810-30418832 TAGAACGGAAAGGTGGAGGAAGG + Intergenic
971799205 4:31266652-31266674 TAGTAGAAGAAAGAGGAGGATGG - Intergenic
971881169 4:32375261-32375283 AAGATGAAGAAGGGGGAGGAGGG - Intergenic
972047895 4:34692376-34692398 TAGAACAGAAAGGCAGAGGAGGG - Intergenic
972131116 4:35834454-35834476 AAGAAGAAGAAGGTGCAGTATGG - Intergenic
972842787 4:42951201-42951223 TAGAACAAAAAGGCAGAGGAAGG - Intronic
973092100 4:46149198-46149220 TAGAACAAAAATGTGGATTAGGG + Intergenic
973754499 4:54061519-54061541 TAAAAAAAAAAGGTGGAGGAGGG + Intronic
973942303 4:55923505-55923527 TAGAGTGAAAAGGTGGAGGAAGG - Intergenic
973984583 4:56337923-56337945 TAGAATGAAAAGGTAGAGGAGGG - Intergenic
973996434 4:56463962-56463984 TAGAACAAAAAAGGGGAAGAAGG + Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974276613 4:59728575-59728597 TAGAACAGAAAGGCAGAGGAAGG + Intergenic
974288730 4:59903808-59903830 TAGAAGAAAAAGGCAGAGGAAGG - Intergenic
974705951 4:65515875-65515897 TAGAACAAAAAGGAGGAGAAAGG + Intronic
975051050 4:69865474-69865496 TAGAACAAAAAGGTAGATGAAGG + Intergenic
975471260 4:74771164-74771186 TAGAAAAAGAAAGAAGAGGAGGG + Intronic
975482961 4:74902281-74902303 TGCAACAAAAAGCTGGAGGAAGG - Intergenic
975533295 4:75422551-75422573 CAGAACAAGAAGGCAGAGAAAGG - Intergenic
975788278 4:77918139-77918161 TGGAACAAGTAGGTCAAGGATGG + Intronic
975815951 4:78217176-78217198 TAGAACAAAAAGGCAGAGGAAGG - Intronic
976324247 4:83752659-83752681 TAGAACAAAAAGGTGAAGGAAGG + Intergenic
976379122 4:84379446-84379468 TCGAACAAGAAGATGGAGTGGGG + Intergenic
976657692 4:87506492-87506514 TAGAACAAAAAGGCAGGGGAAGG + Intronic
976677316 4:87717760-87717782 TAGAACTACACTGTGGAGGATGG + Intergenic
976759442 4:88532460-88532482 TAGAATAAAAAGGTGGAGGAAGG - Intronic
976808924 4:89079093-89079115 TAGAACAAAAAGGTGGAAGAAGG - Intronic
977131659 4:93247410-93247432 TAGAACAAAAAGGCAGAGAAAGG + Intronic
977147531 4:93463691-93463713 TAGAACAAGCAGGTGCTGGCTGG + Intronic
977300221 4:95259055-95259077 TAGAATAAGATGGTCGAGGCCGG - Intronic
977306958 4:95335638-95335660 AAGAAGAAGAAAGTGGAAGATGG + Intronic
977411691 4:96674315-96674337 TAGAACAAAAAGGCTGAGTATGG + Intergenic
977499160 4:97816660-97816682 TAGAACAAAAAGGCAGAGAAAGG + Intronic
978344454 4:107752439-107752461 TAAAACAAAAAGATGGAGGAAGG - Intergenic
978475369 4:109122347-109122369 TAGCACAGGAAGGTGAAGGGTGG + Intronic
978485620 4:109250633-109250655 TAGAACAAAAAGGTAGAATAAGG - Intronic
978669748 4:111232531-111232553 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
978811022 4:112849950-112849972 TAGAACAAAAAGGTGAAGGAAGG + Intronic
978827421 4:113042148-113042170 TAGAACAAAAAGGGAGACGAAGG + Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979027147 4:115592112-115592134 TAGAACAATAAGGTAGAGGAAGG - Intergenic
979210849 4:118100199-118100221 TAGAACTAAGAGGTGGAGGAAGG + Intronic
979223690 4:118260306-118260328 TAGAATGAGAAGGTGGAAGAAGG - Intergenic
979687430 4:123526225-123526247 TAGAACAAGAGGGAAAAGGAAGG - Intergenic
979732080 4:124036634-124036656 TAGAACAAAAAGACAGAGGAAGG - Intergenic
979887305 4:126045316-126045338 TAGAGCAAAAAGATGGAGGAAGG + Intergenic
979994225 4:127411177-127411199 TAGAACAAATAGGTAGAGGAAGG + Intergenic
979997124 4:127444408-127444430 TAGAACAAAAAGGCGATGGAAGG + Intergenic
980071465 4:128246818-128246840 AAGAAAAAGTAGGGGGAGGAAGG + Intergenic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980225152 4:129974041-129974063 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
980239749 4:130158383-130158405 TAGAACAAAAAGATGGAAGAAGG + Intergenic
980382707 4:132045295-132045317 TAGAACAAAAAGGCAGAGGGAGG - Intergenic
980402754 4:132313873-132313895 TAAAATAAAAAGGTGGAGGAAGG - Intergenic
980498420 4:133615534-133615556 TAGAACAAAACGGCAGAGGAAGG + Intergenic
980526861 4:134000721-134000743 TAGAACCAGAAAGTGGAGAAAGG + Intergenic
980736396 4:136895175-136895197 TAGAACAAAAAGCTAGAGGAAGG + Intergenic
980792145 4:137633432-137633454 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
980807622 4:137833811-137833833 TAGAATAAAAAGGTGGAGAAAGG - Intergenic
980858293 4:138467252-138467274 TAGAAAAAAATGGTAGAGGAAGG + Intergenic
980907596 4:138963311-138963333 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
980971558 4:139572187-139572209 AAGAAGAAGAAGATGGAAGATGG - Intronic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981041900 4:140230866-140230888 TAGAACAAAAAGGAGGAGAAAGG - Intergenic
981120041 4:141039344-141039366 TAGAGAAAGAAAGGGGAGGAAGG + Intronic
981353581 4:143761201-143761223 TAGAACAGAATGGTGGAGGGAGG + Intergenic
981452849 4:144919266-144919288 TAGAACAAAAAAGTGGAGGAAGG - Intergenic
981634732 4:146863861-146863883 TAGAACAAAAAGGCAGAGGAAGG - Intronic
982278001 4:153656521-153656543 GAGAACAGGAAAGGGGAGGAGGG - Intergenic
982344248 4:154339243-154339265 AAGAACAAAAAGGTGGAGGAAGG - Intronic
982455996 4:155610232-155610254 TAGAACAAAAAGGCATAGGAAGG + Intergenic
982542144 4:156687201-156687223 TTGAACAAGAAGGCAAAGGATGG + Intergenic
982612321 4:157591084-157591106 TGGAACAAGAAGAAGGAGTATGG + Intergenic
982799872 4:159692226-159692248 TAGAAAAAGCAGGTGGAAGTAGG + Intergenic
983620962 4:169760491-169760513 TAAAACAAAAAGGTAGAGGAAGG - Intergenic
983841479 4:172461986-172462008 TAGAAAAAAAAGGCAGAGGAAGG + Intronic
983954332 4:173679486-173679508 TAGAACAGAAAGGCAGAGGAAGG - Intergenic
984051739 4:174872888-174872910 CAGAACAAAAAGGTGAAGGAAGG + Intronic
984144667 4:176045804-176045826 GAGAACAAAAAGGCAGAGGAAGG - Intergenic
984546546 4:181111210-181111232 AAGCACTAGAAGGTGGAGTATGG + Intergenic
984590778 4:181615210-181615232 TAGAAAATTAAGCTGGAGGATGG - Intergenic
985066409 4:186126503-186126525 TAGAACAAAAAGGCAGAGGAAGG + Intronic
985957986 5:3278805-3278827 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
986130323 5:4924001-4924023 TAGAGCAAAAAGGCAGAGGAAGG + Intergenic
986173203 5:5330527-5330549 TAGAACAAGAAGGCAGAAAAAGG + Intergenic
986277981 5:6297367-6297389 TAGAAGAAGAAGGCTGAGGTGGG - Intergenic
986420075 5:7571411-7571433 CAGAACAGAAAGGTGGAGGAAGG - Intronic
986728436 5:10617576-10617598 TAGAAGAATGGGGTGGAGGAAGG - Intronic
986757734 5:10853803-10853825 TAGAATAAAAAGGTAGAGGAAGG + Intergenic
987528818 5:19088422-19088444 TAGAACACAGAGGAGGAGGAGGG - Intergenic
987581152 5:19794341-19794363 TAGAAGAAAAAGATGGAGAAAGG + Intronic
987820661 5:22961961-22961983 TAGAACAAAAAGGCTGGGGAGGG + Intergenic
987962969 5:24834239-24834261 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
987989581 5:25193188-25193210 TAGAACAAGCAGGTGGAGAGAGG + Intergenic
988034953 5:25815488-25815510 TAGAGCAAAAAAGTAGAGGAAGG - Intergenic
988211986 5:28215856-28215878 GAGAAGAAGGAGGTGGGGGAGGG - Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988222818 5:28370999-28371021 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
988942693 5:36162067-36162089 TAGAACAGAAAGGTGGATGCAGG - Intronic
988947316 5:36218717-36218739 GAAAAGAGGAAGGTGGAGGAAGG - Intronic
989283060 5:39666962-39666984 TACAAGAAAAAGGTGGAAGAAGG - Intergenic
990001862 5:50902731-50902753 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
990245093 5:53856683-53856705 TAGAAAAAGCAGGCGGAAGAAGG - Intergenic
990300623 5:54445989-54446011 TAGAACAAAAAGGAGGAGGAAGG + Intergenic
990336726 5:54780505-54780527 TAGAACAAAAAGGCAGAGAAAGG + Intergenic
990528435 5:56651140-56651162 CAGAACAAAAAGGCTGAGGAAGG + Intergenic
990598049 5:57330873-57330895 TAGAAGAAAAAGGCAGAGGAAGG - Intergenic
990653555 5:57929479-57929501 TAGAACAAAAAGGCAGAGAAAGG + Intergenic
991104713 5:62831390-62831412 TAGAACAAAAAGGTAGAGAAAGG + Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991145112 5:63292854-63292876 TAGAACAAAAAAGCAGAGGAAGG + Intergenic
991196279 5:63936335-63936357 TAAATGAAGAAGGAGGAGGAGGG + Intergenic
991444398 5:66683769-66683791 TAGAAAAGCAAGCTGGAGGATGG - Intronic
991499003 5:67257136-67257158 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
991716890 5:69459494-69459516 TAGAACACAAAGGCAGAGGAAGG - Intergenic
992010269 5:72518720-72518742 TAAAACAAGATGGTGTGGGATGG + Intergenic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992209082 5:74459937-74459959 TAGAACAAAAAGGCAGAGGATGG + Intergenic
992501298 5:77346800-77346822 TAAAACAAGAGGAAGGAGGAAGG + Intronic
992530058 5:77644996-77645018 GAGAAAAAAAAGGGGGAGGAAGG - Intergenic
992583289 5:78204555-78204577 TGGAACAAAAGGCTGGAGGATGG - Intronic
992948074 5:81829214-81829236 TAGAAAAAGCAGGTGGATGAAGG + Intergenic
992948375 5:81832237-81832259 TAGAACAAAAAGATGGAGCAAGG - Intergenic
993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG + Intergenic
993100855 5:83538170-83538192 AAGAAAAGGAAGGAGGAGGAGGG + Exonic
993383311 5:87233049-87233071 TAGAACAAAAAGGTAGAGGAAGG - Intergenic
993475371 5:88357866-88357888 TTGAACAAAAAGGCAGAGGATGG - Intergenic
993558490 5:89372672-89372694 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
993590374 5:89788095-89788117 TAGAACAAAAATGTGGAGGAAGG + Intergenic
993854521 5:93056706-93056728 TAGAACAAAAAGGCAGATGAAGG + Intergenic
994029871 5:95129635-95129657 GAGAACAAAAAGGCAGAGGATGG + Intronic
994031769 5:95151395-95151417 GAGAAGGAGAAGGTAGAGGAGGG + Intronic
994051687 5:95369397-95369419 TAGGACTATGAGGTGGAGGAGGG - Intergenic
994134146 5:96265554-96265576 TAGAACAAAAAGGTAGAGGAAGG - Intergenic
994160065 5:96547462-96547484 TAGAACAAAAAGGCAGAAGAAGG - Intronic
994653274 5:102556712-102556734 GACTACTAGAAGGTGGAGGAGGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995137241 5:108693002-108693024 TAGAAGAAAAAGGTGAAAGAAGG - Intergenic
995148373 5:108811860-108811882 TGGAACAAAAAGGAGGAGGAAGG - Intronic
995405741 5:111793477-111793499 TAGAAGAAAAAGGCAGAGGAAGG - Intronic
995483347 5:112614627-112614649 TAGAAGAAAAAGGTGGAGGAAGG - Intergenic
996282894 5:121753475-121753497 TAGAACAAAAAGGCAGAAGAAGG + Intergenic
996480245 5:123967601-123967623 CAGAACAAAAAAGTAGAGGAAGG + Intergenic
996845536 5:127895144-127895166 TAGAAGAAGGTGGTGGGGGAGGG - Intergenic
996944153 5:129046548-129046570 TAGAAAAAAAAGATGAAGGAAGG - Intergenic
997348928 5:133216284-133216306 AAGAACAGGAAGATGGAGCAGGG - Intronic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997801606 5:136868252-136868274 TAGAACAAAAAGGCAGAGGACGG + Intergenic
998345011 5:141454694-141454716 TGGAATAAGCAGGTGGAGCATGG - Intronic
998542638 5:142997348-142997370 TGAAACAAGAAGGTAGAGTAGGG - Intronic
998616053 5:143741710-143741732 TAGTACAAGAAAATGAAGGAAGG + Intergenic
999146720 5:149400905-149400927 TAGAACAAAAGGGTGGAGGAGGG - Intronic
999643421 5:153694961-153694983 ATGAACAAGAAGGAGGAGAAAGG + Intronic
999696951 5:154195696-154195718 TAGAACAAGAACTTGGAGAATGG - Intronic
1000399049 5:160806050-160806072 GAGAACACAAAAGTGGAGGAAGG - Intronic
1000617450 5:163443706-163443728 TAGAACAAGGTTGTGGAGAAAGG - Exonic
1000914610 5:167065399-167065421 TAGAAGAAGAAAGTGAAGAAGGG - Intergenic
1001409962 5:171504355-171504377 TAGAACAACAAAGTGAAGAAGGG + Intergenic
1001719974 5:173848796-173848818 AAGAAGAAGAAGCTGGAGGCAGG - Intergenic
1001832751 5:174803282-174803304 TAGAACAAAAAGGCAGAGGCAGG + Intergenic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002667396 5:180835235-180835257 TGGAACAAAAAGGTGGAAGAAGG + Intergenic
1002716343 5:181230583-181230605 TGAAAGAAGAAAGTGGAGGAAGG + Intronic
1003013692 6:2450789-2450811 TAGCACAAGCAGGTGGGGCATGG + Intergenic
1003233721 6:4277412-4277434 TAGAACAAAAAGGCAGAGGGAGG + Intergenic
1003243416 6:4364194-4364216 TAGAACAAAAAGACAGAGGAAGG - Intergenic
1003414930 6:5898959-5898981 CAGCAGCAGAAGGTGGAGGAAGG - Intergenic
1003473005 6:6454214-6454236 TAGAACAACAAGGTGGAGGAAGG + Intergenic
1003559648 6:7170237-7170259 TGGGACCAGAGGGTGGAGGAAGG - Intronic
1003744800 6:8988465-8988487 TAGAACAAAAAGGCAGAGGTAGG + Intergenic
1003767100 6:9250667-9250689 TAGGAAAAGAAGGGAGAGGAAGG - Intergenic
1003769863 6:9288308-9288330 TAGAATAACAATGTGGAGGAAGG + Intergenic
1004308531 6:14523067-14523089 TAGAACAAGAAGATGAAGGAAGG - Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005158039 6:22830594-22830616 TAGAACAAAAAGGGAGAGGAAGG - Intergenic
1005482439 6:26267549-26267571 TAGGAAATGAAGGTGGAGAAAGG - Intergenic
1005626016 6:27663204-27663226 TGGTACAAATAGGTGGAGGAAGG + Intergenic
1005706282 6:28457028-28457050 TAGAATAGGAAGGTGGGGGTGGG - Intergenic
1006234427 6:32616140-32616162 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1006376904 6:33676751-33676773 CTGAACCTGAAGGTGGAGGATGG - Exonic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007396263 6:41579453-41579475 TAGAACAGGAAGGAGTAGGCTGG + Intronic
1007646931 6:43390135-43390157 TAGAGCAAGATGGTGGGGGAGGG - Intergenic
1007773301 6:44208442-44208464 GAGTATAAGAAGGTGGAGAAGGG - Intergenic
1008078352 6:47169398-47169420 TAGAACAAAAAGATGGAGTAAGG - Intergenic
1008413290 6:51208421-51208443 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
1008742848 6:54630697-54630719 TAGAACAAAAAGGAGTAGGAAGG + Intergenic
1008875143 6:56317819-56317841 GAGATCAAGTAGGTGAAGGAAGG - Intronic
1008935378 6:56986690-56986712 CAAGAAAAGAAGGTGGAGGAGGG - Intronic
1009291609 6:61889654-61889676 TAGAACATGCGGGTGGAGGTAGG - Intronic
1009533026 6:64844569-64844591 TAGAACTAGTAGGTGAAAGAAGG - Intronic
1009541289 6:64962438-64962460 CAGAACAAGTAGGTGGGGCATGG + Intronic
1009547191 6:65034606-65034628 AAGAACTTGAAGGTGGAGCAGGG - Intronic
1010292432 6:74153299-74153321 TAGAGCAAAAAGGTGCAAGAAGG + Intergenic
1010351166 6:74876289-74876311 AAGAAGAACAAGGAGGAGGAAGG + Intergenic
1010648986 6:78428532-78428554 TAGAACAAAAAGTTTTAGGAAGG + Intergenic
1010918489 6:81650427-81650449 TAGAACAAAAAGGCAGAGAAAGG + Intronic
1010959838 6:82133350-82133372 TAGTACAAAAAGGGGGAAGAGGG - Intergenic
1011176784 6:84570762-84570784 TAGAACAAAAGGTGGGAGGAAGG - Intergenic
1011483486 6:87818454-87818476 TGATACAAGAAGGTGGAGGAGGG - Intergenic
1011500359 6:87981721-87981743 TAGAACAAAAGGGTGGAGTAAGG - Intergenic
1011591715 6:88976214-88976236 TGAAACCAGAAGGTGGAGGTTGG + Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011781002 6:90789275-90789297 TAGAACAAAAATGTGAAGGAAGG - Intergenic
1012027569 6:94016979-94017001 TAGAACAAAAAGGCAGAAGAAGG + Intergenic
1012124562 6:95411770-95411792 TAAAACAAAAAGGTGGAATAAGG + Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012272211 6:97227396-97227418 CAAAACAAGAAGGAAGAGGAGGG - Intronic
1012554062 6:100490740-100490762 TAGAACAAGAAGGCCGAGATTGG - Intergenic
1012859610 6:104543887-104543909 TAGAGCAAAAAGGTGCAGAAAGG - Intergenic
1013300920 6:108804294-108804316 GAGAAACAGAAGGTGGAGGTAGG + Intergenic
1013700090 6:112756751-112756773 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1013751386 6:113410746-113410768 GAGAAAAAGAAAGTGGAGGAGGG + Intergenic
1013893609 6:115057268-115057290 TAGAGCAAAAAGGTGGAGAAAGG + Intergenic
1013990767 6:116252153-116252175 TAGAACAAGCTGGTGGCTGATGG - Exonic
1014015182 6:116521548-116521570 TAGGACAAAAAGGGAGAGGATGG - Exonic
1014042846 6:116849879-116849901 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1014054413 6:116997174-116997196 TGGAACAAAAAGGTGGAGGAAGG + Intergenic
1014399299 6:120967212-120967234 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1014453630 6:121611479-121611501 GAGAACAAGAAGGGGGAAGCAGG - Intergenic
1014469395 6:121796739-121796761 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1014688276 6:124530894-124530916 TAGAACAAAAAGATGGAAGAAGG - Intronic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1014924270 6:127252877-127252899 TTGAACAAAAAGGTGGAAGAAGG - Intergenic
1015153362 6:130063319-130063341 TAGAAGCTGAAGGAGGAGGAGGG + Intronic
1015419278 6:132987487-132987509 TAGAAAAAGATGGCGGGGGAAGG + Intergenic
1015603713 6:134935058-134935080 GAGAACAAGTACTTGGAGGAGGG - Intronic
1015752349 6:136573205-136573227 TAGAACAAAAAGATGGAGAAAGG + Intronic
1015806072 6:137109981-137110003 TAGAACAAAAAGGTGGATGAAGG + Intergenic
1015818426 6:137234227-137234249 GAAAACAAGGAAGTGGAGGAAGG + Intergenic
1015882556 6:137883612-137883634 GAAAACAAGAGGGAGGAGGAGGG + Intergenic
1016431365 6:143989449-143989471 TAGAACAAAAAGGTGGAAGGAGG + Intronic
1016594976 6:145788828-145788850 TAAAACAAAAACATGGAGGAAGG + Intergenic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1016913437 6:149222058-149222080 TGGAACAAAAAGGTAGAGAAAGG + Intronic
1017055395 6:150431435-150431457 TAGAACCAGAAGCAGGAGGGGGG + Intergenic
1017326122 6:153143348-153143370 TAGCACAAGGAGGTGGGGAAGGG - Intergenic
1017576173 6:155807197-155807219 GAGAACCAGAACGTGAAGGAAGG + Intergenic
1017577649 6:155822705-155822727 TACAACAAAAAGGCAGAGGAAGG + Intergenic
1017680982 6:156863339-156863361 TAGGGCAAGAAGGTGTGGGATGG + Intronic
1018220343 6:161571858-161571880 CAGAACAAGAAGGCAGAGAACGG + Intronic
1018285923 6:162237607-162237629 CACAAAAAGAAGGTGGAGAAAGG + Intronic
1018645435 6:165943645-165943667 TAGAATGAAAAGGTGGAGGAAGG - Intronic
1018786413 6:167111714-167111736 GAGACAAATAAGGTGGAGGAAGG - Intergenic
1019066085 6:169299229-169299251 TAGAACAAAAAGACAGAGGAAGG - Intergenic
1019224495 6:170498894-170498916 GAGAACAAAAAGTTAGAGGAAGG - Intergenic
1019227113 6:170522452-170522474 GAGAAAAAGAAGGCGGGGGACGG + Intergenic
1019259048 7:70128-70150 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1019786742 7:2981949-2981971 TAGAACAGAAAGTCGGAGGAGGG + Intronic
1020254165 7:6492773-6492795 TAGAGGAGGAAGGAGGAGGAGGG + Intergenic
1020680618 7:11232473-11232495 TTGAAAGAGAAGGTGGAGGAGGG + Intergenic
1020741879 7:12030326-12030348 CAGGACAGGAGGGTGGAGGAAGG + Intergenic
1021086943 7:16431927-16431949 TAGAACAAAAAAGTGGAAGAAGG + Intergenic
1021225822 7:18025099-18025121 AAGAAAAAGAAGGTGGAGCAGGG - Intergenic
1021332351 7:19354505-19354527 TAGAACAAAAAGGTGGAGAAAGG + Intergenic
1021349942 7:19580157-19580179 TAGAACAAAAAGGTTTAAGAAGG - Intergenic
1021603454 7:22387794-22387816 TATAACAAGAAGCAGGAGGATGG - Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1022035431 7:26529578-26529600 CAGAACAAGAGGTTGGAGGAAGG - Intergenic
1022260869 7:28703698-28703720 TAGAAGAAAAAGGTGGAGGAAGG - Intronic
1022632340 7:32097102-32097124 TAGAACAAAAAGGCTGAGTAAGG - Intronic
1022664995 7:32402496-32402518 TAGAACAAAATGGTGGAAGAAGG - Intergenic
1022846623 7:34216333-34216355 TAGAACAAGAAGGTGGAGGAGGG - Intergenic
1023187001 7:37542451-37542473 TAGAACAAGAGGGTGAAGGAAGG + Intergenic
1023227731 7:37988945-37988967 TAGAACAAGAAGGTGGAGGAAGG - Intronic
1023336102 7:39172543-39172565 TAAAACATGAAGGTGGGGGTGGG - Intronic
1024012702 7:45283647-45283669 TAGAACAAAAAGGTGAAGCAAGG - Intergenic
1024401589 7:48929627-48929649 TAGAACAAAAAGTTGAAGGAAGG + Intergenic
1024465376 7:49706625-49706647 TGTAACAGGAATGTGGAGGATGG - Intergenic
1024551713 7:50567645-50567667 TAGAACAAAAAGGTGGATGAAGG - Intergenic
1024681398 7:51693367-51693389 TAGAGCAGGCAGGTGGAAGAGGG + Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1024871684 7:53970640-53970662 TAGAACAAAAAGCAGGAGGAAGG - Intergenic
1025706045 7:63865150-63865172 GACAACAAGAAGGTCAAGGAAGG - Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1026205617 7:68255040-68255062 AAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1026217178 7:68359907-68359929 TAGAAGAAAAAGGTAGAGGAAGG + Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026358491 7:69581021-69581043 TAGAACAAAAAAGTGAAGGAAGG + Intergenic
1026397730 7:69974640-69974662 CAGAACAAAAAGGCAGAGGAAGG - Intronic
1026565164 7:71483956-71483978 CAAGACAAGAAGGTGGAAGATGG - Intronic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1027174157 7:75892821-75892843 TAGGACAAGAAAGTGGAGTGTGG + Intergenic
1027532234 7:79350536-79350558 CAGAACTATAAGGTGGAAGAGGG - Intronic
1027559060 7:79704374-79704396 TAGAACAAAAAGGCAGATGAAGG + Intergenic
1028227698 7:88268070-88268092 TAGGGCTAGAAGGTGGGGGAGGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028341526 7:89726927-89726949 TGGAACAAAAAGATAGAGGAAGG + Intergenic
1028392210 7:90329512-90329534 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1028541445 7:91946708-91946730 TAGAGAGAGAATGTGGAGGAAGG + Intronic
1028711515 7:93914500-93914522 TGAACCCAGAAGGTGGAGGATGG + Intergenic
1028915487 7:96254263-96254285 TAAACCAAAAAGGTGGAGAAAGG + Intronic
1028922857 7:96326126-96326148 TATAAAAAGGAGGTAGAGGAAGG - Intergenic
1029013646 7:97290568-97290590 AGGAAGAAGAAGGGGGAGGATGG + Intergenic
1029021509 7:97369626-97369648 GAAAAAAAAAAGGTGGAGGAAGG - Intergenic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030166630 7:106562110-106562132 TAGAACAAAAAGGTGAAGGAAGG + Intergenic
1030345297 7:108426552-108426574 TAAAACAAGAAGGTCTAAGATGG + Intronic
1030703801 7:112669762-112669784 TAGAACAAAAAGGCCAAGGAAGG + Intergenic
1030765898 7:113409261-113409283 TTGAATAAAAAGGTAGAGGAAGG + Intergenic
1030960348 7:115912571-115912593 TGGAGCAAGAAGGGTGAGGATGG - Intergenic
1031208229 7:118790201-118790223 AAGAAGAAAGAGGTGGAGGAGGG + Intergenic
1031280237 7:119790609-119790631 GAGAGCAAGAGGGTAGAGGAGGG + Intergenic
1031528625 7:122850676-122850698 GAGTACTAGAAGCTGGAGGATGG - Intronic
1031559498 7:123221128-123221150 GAGAACAAAAAGGTGGAAGAGGG - Intergenic
1031667492 7:124503060-124503082 GAGAAGAAGAAGGGGGAGAAAGG + Intergenic
1031818196 7:126466719-126466741 TAGAACAAAAAGGTACAGGAAGG - Intronic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032159691 7:129501250-129501272 TAGACCAAGAAGCAGGAGTAGGG - Intergenic
1032251880 7:130264723-130264745 TAGAAGGAGAAGGTGGGGAAAGG - Intergenic
1032491240 7:132326136-132326158 TAGAACAAAAAGGTGGAGGAAGG + Intronic
1032515033 7:132500461-132500483 GAGAAGAAGAAGGAGGGGGAGGG + Intronic
1032655229 7:133921256-133921278 TAGAACAGAAAGGTGGAGATGGG - Intronic
1032670417 7:134077292-134077314 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1032704904 7:134413317-134413339 TTGAACGGAAAGGTGGAGGAGGG - Intergenic
1032766662 7:135000410-135000432 TAGAACAAAAGGATGGAGGAAGG + Intronic
1032853090 7:135811868-135811890 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
1033048215 7:137981250-137981272 GAGAATAGGAAGGTGGAGCATGG + Intronic
1033155996 7:138957449-138957471 AAGAAGAAGAAGGAGAAGGAGGG - Intronic
1033291879 7:140092072-140092094 TAGATCCTGAAGGAGGAGGAAGG + Exonic
1033395176 7:140967105-140967127 TAGTACCAGCAGGTGGAGAAGGG - Intergenic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033858363 7:145593996-145594018 TAGAACAAAAAGGTGGAGGAAGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034071982 7:148194774-148194796 TGGAACAAAAAGGTGAAGGAAGG - Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034374517 7:150630501-150630523 AAGAAGGAGGAGGTGGAGGAAGG + Intronic
1034589115 7:152124546-152124568 TAGAACAAAAAGGTGAAGGAAGG + Intergenic
1034753469 7:153592419-153592441 CAGAACAAAAAGGTGGAATAAGG - Intergenic
1034761016 7:153671820-153671842 TGGAACAAGAACGTGTAGAAGGG - Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035530298 8:345829-345851 TAGAACACAGAGGTGGAGGAGGG + Intergenic
1035595312 8:853233-853255 CAGAGGGAGAAGGTGGAGGAGGG + Intergenic
1035642834 8:1197077-1197099 AAGAACAAAAAGGTGGAGAAAGG - Intergenic
1036078778 8:5529693-5529715 GAGAAAAAGAAGGTGGGGGAAGG + Intergenic
1036094805 8:5711845-5711867 TAGAACCAAAAGGTAGAGAAAGG - Intergenic
1036154019 8:6325346-6325368 TGGAATAAGGAGCTGGAGGATGG - Intergenic
1036526203 8:9537162-9537184 TAGAACAAAAAGATGGAGGAAGG + Intergenic
1036573140 8:9999397-9999419 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1036624899 8:10462055-10462077 TAGAACAAAAAGGTTGAGGAAGG + Intergenic
1036636886 8:10557315-10557337 TAGAACAAAAAGACAGAGGAAGG + Intergenic
1036724827 8:11210556-11210578 TAGAACAAAAGGGCAGAGGAAGG - Intergenic
1037058976 8:14482736-14482758 TAGAACAAAAAGGCAGAGGAAGG + Intronic
1037648310 8:20813852-20813874 TAGGACAGGAATATGGAGGATGG - Intergenic
1037670490 8:21011419-21011441 TAGAACAAAAAGGCTGGGGAAGG - Intergenic
1038115000 8:24543833-24543855 TGGAGCAAAAAGGTGGAGGAAGG + Intergenic
1038118636 8:24586576-24586598 TAGAACAATAAGATAGAGGAAGG + Intergenic
1038234314 8:25737153-25737175 GAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1038284965 8:26198493-26198515 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1038381221 8:27096154-27096176 TAGAACAAGAAGGTGGAGAAAGG + Intergenic
1038393745 8:27231199-27231221 TAGAACAAGAGGGTGTAGGAAGG - Intergenic
1038882201 8:31627561-31627583 GAGAAAAAGAAGGAGGGGGAGGG - Intergenic
1038898296 8:31812580-31812602 TAAAAAAGGAAGGAGGAGGAAGG - Intronic
1039094312 8:33866907-33866929 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1039691304 8:39867669-39867691 GAGAAGAAGAAGGAGGGGGAAGG - Intergenic
1039751915 8:40486398-40486420 GAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1039811872 8:41056342-41056364 TAGAACTGGAGGGAGGAGGAGGG + Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040106220 8:43543715-43543737 TATAACAAAAAGTTGAAGGAAGG - Intergenic
1040800014 8:51330057-51330079 TGGAACAAAAAATTGGAGGAAGG - Intronic
1041061551 8:54039706-54039728 TAGAAAAAGAACATGGAGGGGGG - Intergenic
1041115950 8:54537031-54537053 AAGAAGAATAAGGTGGAAGAAGG - Intergenic
1041119057 8:54568125-54568147 TAGAACAAGAAGGAGGAAAAGGG + Intergenic
1041555028 8:59143779-59143801 TAGAACAAAAATGTGAAAGAAGG - Intergenic
1041786728 8:61642545-61642567 TAAAACAAGAAGGTGGCTTAAGG + Intronic
1041886404 8:62814237-62814259 CAGAAGAAGAAGGTGGGGAAAGG - Intronic
1041977025 8:63811145-63811167 TAGAACAAAAAAGCAGAGGAAGG - Intergenic
1042130425 8:65582480-65582502 AAGAAGAAGAAGGAGGAGAAGGG + Intergenic
1042200108 8:66273350-66273372 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1042357953 8:67850024-67850046 TAAAATAAAAAGGTGGATGAAGG - Intergenic
1042388282 8:68202961-68202983 TGGAACAAAAAGGAAGAGGAAGG - Intronic
1042913579 8:73851978-73852000 AGGAAAGAGAAGGTGGAGGAAGG + Intronic
1043003638 8:74791018-74791040 TAGAACAAAAAGGCAGAGGAAGG - Intronic
1043074104 8:75674185-75674207 TAGAACAAAAAGGCAGGGGAAGG + Intergenic
1043164133 8:76882301-76882323 TAGAACAAAAAGTCAGAGGAAGG + Intergenic
1043192970 8:77250225-77250247 TGGAACCAAAAGGTAGAGGAAGG + Intergenic
1043270517 8:78327598-78327620 TAGAACAAAAAGGCAGAAGAAGG + Intergenic
1043551377 8:81376840-81376862 TCAGAGAAGAAGGTGGAGGATGG + Intergenic
1043589921 8:81818662-81818684 AACAACAAGAAGTTAGAGGAAGG - Intronic
1043850971 8:85216229-85216251 TAAGACAAGAAGGTCCAGGAAGG - Intronic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1043974883 8:86573252-86573274 TAGAACAAAAATATGGAGGAAGG + Intronic
1044051353 8:87509710-87509732 TAGAACAGAAAGGTGGAAGAAGG + Intronic
1044351945 8:91176738-91176760 TAGAACAAAAAGGTGGAGGGAGG - Intronic
1044556060 8:93563291-93563313 TAGAACAAAAAGGTTGAGGAAGG - Intergenic
1044740180 8:95318418-95318440 TAGAACAGAAAGGTGGAGAGTGG + Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044985527 8:97753315-97753337 GAGAAGAAGAAGGAGGAGGTCGG + Intergenic
1045173478 8:99696248-99696270 AAGAACAAGAAGCTTGAGGAAGG + Intronic
1045342931 8:101270420-101270442 TAGAACAGAAAGGCAGAGGAAGG + Intergenic
1045467342 8:102482470-102482492 TAGAATAAAAAGGCAGAGGAAGG + Intergenic
1045734403 8:105278095-105278117 CAGAACAGGAAGGCTGAGGACGG + Intronic
1045818670 8:106308279-106308301 ATAAACAAAAAGGTGGAGGAAGG - Intronic
1045951461 8:107856029-107856051 CAGATGAAGAAGCTGGAGGATGG + Intergenic
1046012790 8:108570874-108570896 TAGAACAAAAAGATGGAGGAAGG - Intergenic
1046035841 8:108840369-108840391 CAGAACAAAAAGGTGGAGGAAGG - Intergenic
1046188043 8:110748673-110748695 TAGAAAGAGCAGGTGGAAGAAGG - Intergenic
1046647906 8:116805775-116805797 TAGAAAAGGCAGGTGGAAGAAGG - Intronic
1046710250 8:117503293-117503315 AGGAAGAAGAAGGAGGAGGAGGG + Intergenic
1046764071 8:118050869-118050891 AAGAATTAGAAGGTGGAGGGAGG + Intronic
1046820613 8:118630410-118630432 TAGAACAAAAAGGTATAGGAAGG + Intergenic
1046968890 8:120198242-120198264 TTGAATAACAGGGTGGAGGATGG - Intronic
1047064978 8:121271761-121271783 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
1047184670 8:122621996-122622018 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1047382628 8:124377359-124377381 TAGAACAAAAAGGCAGAAGAAGG - Intergenic
1047428982 8:124774544-124774566 TGGAGCCAAAAGGTGGAGGAAGG - Intergenic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1047619752 8:126594316-126594338 TAGAACAAAAAGGTGAAAGAAGG - Intergenic
1047690279 8:127345038-127345060 TAGACCAAGAAGGTGTAAGATGG + Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1047965685 8:130044932-130044954 TAGAAGAGGACGCTGGAGGAAGG - Intergenic
1048072590 8:131038577-131038599 TAGAAAAAAAAGGAGGAGAAAGG + Intronic
1048201395 8:132377179-132377201 TAGAACAAAAAGGCAGAGGAAGG + Intronic
1048313242 8:133342479-133342501 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1048575469 8:135686577-135686599 TGGAACAAAAAGGCAGAGGAAGG - Intergenic
1048716871 8:137280993-137281015 TATAACAAAAAGGTGAAGGAAGG + Intergenic
1048921865 8:139238668-139238690 TAGAATAAGAAGGTGGAGAATGG + Intergenic
1050232641 9:3544030-3544052 GAGAAAAACAAGGTGAAGGAGGG - Intergenic
1050487621 9:6150649-6150671 TAGAACAAAAAGGCAGATGAAGG - Intergenic
1050647686 9:7739242-7739264 TACTACAAGAATGTGGAGTAGGG - Intergenic
1050826334 9:9951105-9951127 TAGAATAAGATGTAGGAGGAGGG + Intronic
1051078340 9:13266834-13266856 GAGAAAGAGAAGGAGGAGGAAGG + Intronic
1051135195 9:13912239-13912261 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
1051235078 9:14991021-14991043 TAAAACAAAAAGGTAGAGGAAGG + Intergenic
1051440293 9:17075791-17075813 TAGAACAAAAATATGGAGAAAGG - Intergenic
1051810970 9:21049151-21049173 TGGAATAAAAAGGTGGAGGAAGG - Intergenic
1051863710 9:21654796-21654818 TGGAACAAAAAGGTGGAGGAAGG - Intergenic
1052028871 9:23605932-23605954 TAGAACAAAAAAGCAGAGGAAGG + Intergenic
1052078626 9:24176030-24176052 AAGAATGAGAAGTTGGAGGAAGG - Intergenic
1052436676 9:28438346-28438368 TAGAATAGAAAGGTAGAGGAAGG + Intronic
1053457794 9:38244326-38244348 AAAAACAAGAGGGTTGAGGAGGG + Intergenic
1053527469 9:38844638-38844660 TAGAACAAAAAGGCGGAGAAAGG + Intergenic
1053532038 9:38892026-38892048 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054199693 9:62069067-62069089 TAGAACAAAAAGGCGGAGAAAGG + Intergenic
1054204263 9:62116435-62116457 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054634100 9:67471929-67471951 GAGAACAAAAAGATGGAGGAAGG - Intergenic
1054638662 9:67519290-67519312 TAGAACAAAAAGGCGGAGAAAGG - Intergenic
1054976967 9:71158847-71158869 TAGAACTAAAAAGAGGAGGAAGG + Intronic
1054991468 9:71331942-71331964 AAGAAGAGAAAGGTGGAGGAGGG + Intronic
1055426358 9:76200850-76200872 GATGACAAGAGGGTGGAGGAAGG - Intronic
1055576821 9:77668573-77668595 TAGAACAAAAAGGCAGAGGAGGG + Intergenic
1055645854 9:78360615-78360637 TAGAAAAGGAAAGTGAAGGAAGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055945633 9:81689158-81689180 AAGCACACGAAGGTGAAGGAAGG - Exonic
1056009902 9:82317043-82317065 TAGAACAAAAATGTGGAGGAAGG + Intergenic
1056063287 9:82907071-82907093 CAGAACAAGAAGGTGCAAGGAGG - Intergenic
1056236970 9:84604361-84604383 GAAAAGAAGAAGGAGGAGGAGGG - Intergenic
1056240746 9:84644099-84644121 TAGAATAAAAAGGTGGAGGAAGG - Intergenic
1056371886 9:85964034-85964056 TATAACAAGATTGTTGAGGATGG + Intronic
1056603289 9:88063622-88063644 TCAAACAAAAAGGTGGATGAAGG - Intergenic
1056779809 9:89540997-89541019 TGGAACAAAAAGGTGGAGGAAGG - Intergenic
1056872197 9:90292246-90292268 TAGAACAAAAAGGCAGAGGATGG + Intergenic
1056948085 9:91017846-91017868 TAGAACTATCAGGTGGAGGCAGG - Intergenic
1056958262 9:91099764-91099786 TAGAAAATGAAAGAGGAGGAGGG + Intergenic
1057016622 9:91657862-91657884 GAAAACAAGGAGATGGAGGAGGG - Intronic
1057073545 9:92121331-92121353 TAGAACAAAAAAGCAGAGGAAGG - Intergenic
1057105824 9:92415188-92415210 CAGAACAAGAAGGAGCAGAAGGG - Exonic
1057260543 9:93580622-93580644 TAGAACAAGCAGCTGAAAGAGGG - Intronic
1057336567 9:94160321-94160343 TGGAACAAAAAGGTGGAGGAGGG - Intergenic
1057472441 9:95369537-95369559 TAGAAATTGAAGGTGGAGGAAGG - Intergenic
1057473305 9:95377128-95377150 TAGAACAAAAAGGTGGAAGAAGG + Intergenic
1057693036 9:97303621-97303643 TATAACAATAAGGTGAAAGAAGG - Intergenic
1057729564 9:97596791-97596813 AACAACAAAAAGGTAGAGGATGG - Intronic
1057896456 9:98912781-98912803 GAGGAGAAGAAGGTAGAGGAGGG + Intergenic
1058096177 9:100862716-100862738 TAGAAAAAGCAGGTGGAAGACGG + Intergenic
1058177673 9:101756078-101756100 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058302271 9:103390821-103390843 AAGAACAAAAACTTGGAGGAAGG + Intergenic
1058561109 9:106230117-106230139 TAGAACAGAAAGGTGGGAGAAGG + Intergenic
1058600978 9:106669946-106669968 TAGAACAAAAATGTAAAGGAAGG - Intergenic
1058959021 9:109975374-109975396 TAGAACACAAAAGTGGAGGAAGG - Intronic
1059370018 9:113822641-113822663 TAGAAGAAAAAGATGGAAGAAGG + Intergenic
1059493556 9:114690407-114690429 CAGAACAAAAAGGCAGAGGAAGG - Intergenic
1059590804 9:115659360-115659382 TAATTCAAGAAGGTGGAAGATGG - Intergenic
1059618418 9:115976333-115976355 TAGAACATAAAGTTGGAGAAAGG - Intergenic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1059737722 9:117118895-117118917 TAGAGTGAGGAGGTGGAGGAAGG - Intronic
1060017044 9:120095859-120095881 GAGAACAAAAGAGTGGAGGAAGG - Intergenic
1060025336 9:120166013-120166035 TAGAACCAAAACGTGCAGGAGGG - Intergenic
1060371131 9:123072785-123072807 TGGAACAAGATGATGGAGGCGGG - Intronic
1062074723 9:134579738-134579760 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
1062203229 9:135320108-135320130 TAGAACAAAAAGGTGGAGGAAGG + Intergenic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062665203 9:137666970-137666992 TCGAACAAAAGGGTGGGGGATGG + Intronic
1062745670 9:138210357-138210379 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
1185499346 X:585140-585162 GAGGAGAAGAAGGTGGAGGAGGG + Intergenic
1185602070 X:1347064-1347086 TTGAAAAAGAAGGTGAATGAAGG + Intronic
1185742688 X:2546528-2546550 TAGAGGAAAAAGGTAGAGGAAGG - Intergenic
1185931456 X:4207868-4207890 GAGATAAAAAAGGTGGAGGAAGG + Intergenic
1185944186 X:4356122-4356144 TAGATCAAAAAGGTGGAGAAAGG + Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186045481 X:5532410-5532432 GAGAAGAAGAAGGGAGAGGAAGG + Intergenic
1186047325 X:5550482-5550504 AACAACAAGAAGGAGGAGGAGGG - Intergenic
1186507454 X:10104324-10104346 TAGAGCAAAAGGGTGGAGGAAGG - Intronic
1186529330 X:10279503-10279525 TTGAACAAAAAGGTGGAGAAAGG - Intergenic
1186688112 X:11946745-11946767 TAGAGCAAAAAGGTGAAGGAAGG + Intergenic
1186809495 X:13174357-13174379 TAGAACCAAAAGGCAGAGGAAGG + Intergenic
1187060184 X:15779274-15779296 TAGAACAAAAAGGCAGAGGAAGG - Intronic
1187206500 X:17186792-17186814 CAGAACAAGAAGGTACAGGAGGG - Intergenic
1187310914 X:18141494-18141516 TAGAACAAAAACGCAGAGGAAGG - Intergenic
1187556705 X:20358752-20358774 TAGAACAAAAGGGTGGAGGAAGG - Intergenic
1187623421 X:21084537-21084559 TAGAATGGGAAGGCGGAGGAAGG - Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1188103962 X:26125583-26125605 TAGAACAAAAAGGCAAAGGAAGG + Intergenic
1188495410 X:30778351-30778373 TAGAACAATAAAGTGGAGGAAGG + Intergenic
1188734288 X:33693368-33693390 TAGAACAAAAAGGCAGAGGAAGG - Intergenic
1188990968 X:36819853-36819875 TGGAACAAAAAGGTAGAAGAAGG + Intergenic
1189073826 X:37894779-37894801 TAGAACAAAAAGGTGGAGGAAGG + Intronic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189142122 X:38618052-38618074 AACATCAGGAAGGTGGAGGAAGG + Intronic
1189240954 X:39523983-39524005 TAGAACAAAAGGGTGGAGGGAGG - Intergenic
1189372101 X:40436732-40436754 TAGAACAAAAAGGCTGAGTAAGG + Intergenic
1189454803 X:41176260-41176282 CAGACCATGAAGGAGGAGGAGGG - Intronic
1189804026 X:44717737-44717759 TAGAACAAAAAGATGGAGGAAGG - Intergenic
1189933811 X:46043513-46043535 TAGAGCAAAAAGGAAGAGGAAGG + Intergenic
1190129674 X:47735446-47735468 TAGAACAAAAAAATGGAGGAAGG - Intergenic
1190969023 X:55330986-55331008 TACAACAAAAAGGTGGGGGAAGG + Intergenic
1191045204 X:56129080-56129102 TAGATCTAGATGGTGTAGGAAGG - Intergenic
1191110045 X:56797150-56797172 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
1191141753 X:57121772-57121794 CAGACTAAGAAGGTGGAGGTGGG - Intergenic
1191830091 X:65407050-65407072 AAGCACACGAAGGTGAAGGAAGG + Intronic
1192191038 X:68991266-68991288 AAGAACAAAGAGATGGAGGAAGG - Intergenic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1192743907 X:73919845-73919867 CAGAACAAGAAGGTGGAATAAGG + Intergenic
1192929076 X:75785550-75785572 GAGGAGCAGAAGGTGGAGGAAGG + Intergenic
1193429261 X:81380527-81380549 TAAAAAAAGAAAATGGAGGATGG - Intergenic
1193563574 X:83049991-83050013 TAGAAAAGGCAGGTGGAAGAAGG - Intergenic
1193568375 X:83108762-83108784 TAGAACAAGACAAAGGAGGAGGG - Intergenic
1194291638 X:92080065-92080087 TAGAAGAGGAAGGCAGAGGAAGG + Intronic
1194626871 X:96235568-96235590 TAGAACAAAAAGATGGAGGAAGG + Intergenic
1195053800 X:101123407-101123429 TAGAACAAGAAGGGGGAATTAGG + Intronic
1195075675 X:101325517-101325539 AAGAAGAAGAAGGTGGATCATGG + Intergenic
1195118129 X:101720407-101720429 GAGATAAGGAAGGTGGAGGAGGG - Intergenic
1195255114 X:103082485-103082507 TTGAAGAAAAAGGGGGAGGAGGG - Intronic
1195373572 X:104203373-104203395 TTGAACATGAAGGTAAAGGAGGG - Intergenic
1195427546 X:104751626-104751648 TAGAACAAGTAGATGGATCAGGG + Intronic
1195590172 X:106615419-106615441 TAGAACAAAATGGTGGAGGAGGG - Intronic
1196226407 X:113172570-113172592 TAAAACAAAAAGATGGAGGGAGG + Intergenic
1196239790 X:113329772-113329794 TTGAACAAAAAGGCAGAGGAAGG - Intergenic
1196758098 X:119175803-119175825 CAGGACAAGAAGGGAGAGGAGGG - Intergenic
1196894668 X:120323153-120323175 TAGAACAAATAGCTGGAGGAAGG - Intergenic
1197633269 X:128886599-128886621 TAGAAAAAGCAGGTGGAAGAAGG - Intergenic
1198058428 X:133018972-133018994 TAGAACAAAAAGGCACAGGAAGG - Intergenic
1198170352 X:134099296-134099318 TAGAATAAAAAGGCAGAGGAGGG + Intergenic
1198447175 X:136728768-136728790 TAGAACAAAAAGGTAGAAGAAGG + Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198527380 X:137515379-137515401 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1199265146 X:145819877-145819899 TAGAAGAAGAAGAAGGAGAAAGG + Exonic
1199493814 X:148430473-148430495 TAGAACACAAAGGTCGTGGAAGG - Intergenic
1199566235 X:149218197-149218219 TAGAACAAAAAGGCAGAGGAAGG + Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1199860924 X:151799996-151800018 TGGAAGAGGAAGGGGGAGGAAGG - Intergenic
1199877271 X:151943861-151943883 TAGAACAAAAAAGTAGAGGAAGG + Intergenic
1200303540 X:155002473-155002495 TAGAACAAAAAGACAGAGGAAGG + Intronic
1200609154 Y:5304644-5304666 TAGAAGAGGAAGGCAGAGGAAGG + Intronic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201712003 Y:17002636-17002658 TAAAAAAAAAAAGTGGAGGAAGG + Intergenic
1201730710 Y:17199776-17199798 TAGAATAAAAAGGTGGAGAAAGG + Intergenic
1201773678 Y:17642525-17642547 TAAAAGAAAAAGGTGGGGGAAGG - Intergenic
1201827878 Y:18263460-18263482 TAAAAGAAAAAGGTGGGGGAAGG + Intergenic
1202592220 Y:26497394-26497416 AAGAGCATGAAGGTGGTGGAGGG + Intergenic