ID: 938307341

View in Genome Browser
Species Human (GRCh38)
Location 2:130264915-130264937
Sequence GGAAAACCCCACAGTGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938307334_938307341 9 Left 938307334 2:130264883-130264905 CCTCTGCTGTGGCCACAGATGGC No data
Right 938307341 2:130264915-130264937 GGAAAACCCCACAGTGGAGTTGG No data
938307330_938307341 30 Left 938307330 2:130264862-130264884 CCAGTTTAAAGTCGCAGGTGCCC No data
Right 938307341 2:130264915-130264937 GGAAAACCCCACAGTGGAGTTGG No data
938307332_938307341 10 Left 938307332 2:130264882-130264904 CCCTCTGCTGTGGCCACAGATGG No data
Right 938307341 2:130264915-130264937 GGAAAACCCCACAGTGGAGTTGG No data
938307338_938307341 -3 Left 938307338 2:130264895-130264917 CCACAGATGGCCAGGGAATAGGA No data
Right 938307341 2:130264915-130264937 GGAAAACCCCACAGTGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938307341 Original CRISPR GGAAAACCCCACAGTGGAGT TGG Intergenic
No off target data available for this crispr