ID: 938307550

View in Genome Browser
Species Human (GRCh38)
Location 2:130265705-130265727
Sequence ACACCAGAGGCTCAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938307543_938307550 11 Left 938307543 2:130265671-130265693 CCCAAGGACAGACATGGCATCCC No data
Right 938307550 2:130265705-130265727 ACACCAGAGGCTCAGGAGCCAGG No data
938307544_938307550 10 Left 938307544 2:130265672-130265694 CCAAGGACAGACATGGCATCCCT No data
Right 938307550 2:130265705-130265727 ACACCAGAGGCTCAGGAGCCAGG No data
938307546_938307550 -9 Left 938307546 2:130265691-130265713 CCCTGGCAACAGCTACACCAGAG No data
Right 938307550 2:130265705-130265727 ACACCAGAGGCTCAGGAGCCAGG No data
938307547_938307550 -10 Left 938307547 2:130265692-130265714 CCTGGCAACAGCTACACCAGAGG No data
Right 938307550 2:130265705-130265727 ACACCAGAGGCTCAGGAGCCAGG No data
938307540_938307550 26 Left 938307540 2:130265656-130265678 CCTGGTTCTGTTGGCCCCAAGGA No data
Right 938307550 2:130265705-130265727 ACACCAGAGGCTCAGGAGCCAGG No data
938307542_938307550 12 Left 938307542 2:130265670-130265692 CCCCAAGGACAGACATGGCATCC No data
Right 938307550 2:130265705-130265727 ACACCAGAGGCTCAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938307550 Original CRISPR ACACCAGAGGCTCAGGAGCC AGG Intergenic
No off target data available for this crispr