ID: 938308047

View in Genome Browser
Species Human (GRCh38)
Location 2:130267896-130267918
Sequence CCACGTGGGCAAAGGGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938308028_938308047 27 Left 938308028 2:130267846-130267868 CCCTGGAACATCAGGAGGAAGGG No data
Right 938308047 2:130267896-130267918 CCACGTGGGCAAAGGGCAGGGGG No data
938308030_938308047 26 Left 938308030 2:130267847-130267869 CCTGGAACATCAGGAGGAAGGGG No data
Right 938308047 2:130267896-130267918 CCACGTGGGCAAAGGGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938308047 Original CRISPR CCACGTGGGCAAAGGGCAGG GGG Intergenic
No off target data available for this crispr