ID: 938310649

View in Genome Browser
Species Human (GRCh38)
Location 2:130286366-130286388
Sequence CAGGCCTGCCCCTCCTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938310641_938310649 13 Left 938310641 2:130286330-130286352 CCACACTTCCAGAGCTCCAATGT No data
Right 938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG No data
938310643_938310649 -3 Left 938310643 2:130286346-130286368 CCAATGTCCCCAGATTTCCTCAG No data
Right 938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG No data
938310640_938310649 14 Left 938310640 2:130286329-130286351 CCCACACTTCCAGAGCTCCAATG No data
Right 938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG No data
938310645_938310649 -10 Left 938310645 2:130286353-130286375 CCCCAGATTTCCTCAGGCCTGCC No data
Right 938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG No data
938310638_938310649 18 Left 938310638 2:130286325-130286347 CCTCCCCACACTTCCAGAGCTCC No data
Right 938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG No data
938310639_938310649 15 Left 938310639 2:130286328-130286350 CCCCACACTTCCAGAGCTCCAAT No data
Right 938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG No data
938310636_938310649 30 Left 938310636 2:130286313-130286335 CCTCCAGTGCTTCCTCCCCACAC No data
Right 938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG No data
938310637_938310649 27 Left 938310637 2:130286316-130286338 CCAGTGCTTCCTCCCCACACTTC No data
Right 938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG No data
938310642_938310649 5 Left 938310642 2:130286338-130286360 CCAGAGCTCCAATGTCCCCAGAT No data
Right 938310649 2:130286366-130286388 CAGGCCTGCCCCTCCTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938310649 Original CRISPR CAGGCCTGCCCCTCCTGTGT AGG Intergenic
No off target data available for this crispr