ID: 938318333

View in Genome Browser
Species Human (GRCh38)
Location 2:130345445-130345467
Sequence GCGGGAACTGGGGTCTCGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 19, 3: 56, 4: 256}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938318333_938318343 2 Left 938318333 2:130345445-130345467 CCTCCCGAGACCCCAGTTCCCGC 0: 1
1: 0
2: 19
3: 56
4: 256
Right 938318343 2:130345470-130345492 CAAGATGTTTGCAAAGGTACTGG 0: 1
1: 0
2: 0
3: 12
4: 152
938318333_938318347 19 Left 938318333 2:130345445-130345467 CCTCCCGAGACCCCAGTTCCCGC 0: 1
1: 0
2: 19
3: 56
4: 256
Right 938318347 2:130345487-130345509 TACTGGTGAGCAGGGAGTGAGGG 0: 1
1: 0
2: 1
3: 20
4: 336
938318333_938318345 11 Left 938318333 2:130345445-130345467 CCTCCCGAGACCCCAGTTCCCGC 0: 1
1: 0
2: 19
3: 56
4: 256
Right 938318345 2:130345479-130345501 TGCAAAGGTACTGGTGAGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 177
938318333_938318341 -4 Left 938318333 2:130345445-130345467 CCTCCCGAGACCCCAGTTCCCGC 0: 1
1: 0
2: 19
3: 56
4: 256
Right 938318341 2:130345464-130345486 CCGCCTCAAGATGTTTGCAAAGG 0: 1
1: 0
2: 0
3: 6
4: 80
938318333_938318346 18 Left 938318333 2:130345445-130345467 CCTCCCGAGACCCCAGTTCCCGC 0: 1
1: 0
2: 19
3: 56
4: 256
Right 938318346 2:130345486-130345508 GTACTGGTGAGCAGGGAGTGAGG 0: 1
1: 0
2: 1
3: 26
4: 325
938318333_938318344 10 Left 938318333 2:130345445-130345467 CCTCCCGAGACCCCAGTTCCCGC 0: 1
1: 0
2: 19
3: 56
4: 256
Right 938318344 2:130345478-130345500 TTGCAAAGGTACTGGTGAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938318333 Original CRISPR GCGGGAACTGGGGTCTCGGG AGG (reversed) Exonic
900207862 1:1439319-1439341 GCAGGATCTGGGGCCTCAGGAGG - Exonic
900314777 1:2051193-2051215 GCGGGGACAGGGGTTTCTGGAGG + Intronic
900414756 1:2529808-2529830 GTGGGAACTCGGGGCGCGGGGGG + Intronic
900584760 1:3427497-3427519 GAGGGAGCTGGGGTCTCAGGGGG - Intronic
901662836 1:10809498-10809520 GTGGGAGCTGGGGGCTAGGGCGG + Intergenic
901770604 1:11528688-11528710 GCGGGGACTGTGGTCTCTGACGG + Intronic
901775982 1:11560660-11560682 GGGGGAACAGGGGGATCGGGGGG + Intergenic
902032104 1:13430568-13430590 GCGGGAACTGGGGCTACGTGTGG + Intergenic
902232139 1:15034913-15034935 GTGGGAGCTGGTGTGTCGGGAGG - Intronic
902304099 1:15524258-15524280 GCGGGTCCTGGGGACTGGGGCGG - Exonic
903072214 1:20732092-20732114 GCGGGGACCGGGGTCGGGGGCGG - Intronic
903459859 1:23513217-23513239 GTGGGAACTGGGGCTTTGGGGGG + Intronic
903780445 1:25817036-25817058 GAGAGAACTGGGGGCTGGGGAGG - Exonic
904063063 1:27726183-27726205 CCGGGAACTGGGGACGCAGGAGG + Intronic
905436208 1:37957026-37957048 GAGGCAAATGGGGTCTCTGGGGG + Exonic
906207015 1:43992249-43992271 GCGGGAGCTGGGGGCTTGAGAGG - Exonic
906799354 1:48722399-48722421 GCTGGAACTGGGGTCGAGTGGGG + Intronic
907385289 1:54121906-54121928 GGGGGATCTGGGGTCTGGGTGGG - Intergenic
912166117 1:107044767-107044789 GCGGGAACTGGGGCTGCGCGCGG + Intergenic
913958840 1:143324062-143324084 GCAGGAACTGGGGTCTGGGGTGG + Intergenic
914053157 1:144149442-144149464 GCAGGAACTGGGGTCTGGGGTGG + Intergenic
914126040 1:144817099-144817121 GCAGGAACTGGGGTCTGGGGTGG - Intergenic
915104094 1:153521798-153521820 GCGGGAACTGGGGCTGCGCGCGG + Intergenic
921234959 1:213117083-213117105 GCAGAAACTGGGGGCTGGGGAGG - Intronic
922717115 1:227883478-227883500 GTGGTCACTGGGGTCTCTGGAGG + Intergenic
923630254 1:235644979-235645001 GTGGGCCCTGGGGTCTCTGGCGG - Intronic
924343681 1:243055685-243055707 GCAGGAACTTTGGACTCGGGAGG + Intergenic
924856691 1:247881375-247881397 GCAGGAACTGGTGTCTTGCGTGG - Intergenic
1064564290 10:16624409-16624431 GCTAGAACTGGGCTCTCAGGAGG - Intronic
1065895866 10:30162866-30162888 GCGGGAACTGGGGCTGCGTGAGG + Intergenic
1066659923 10:37728733-37728755 TCAGGAACTGGGGCCTGGGGTGG - Intergenic
1066758848 10:38736557-38736579 CCGGGAACTGGGGTCTGGGGTGG - Intergenic
1066962790 10:42236211-42236233 CTGGGAACTGGGGTCTGGGGTGG + Intergenic
1067214799 10:44293093-44293115 GCGGGGAGGGGGGCCTCGGGAGG + Intronic
1068863135 10:61867656-61867678 GCGGGAACTGGGGCTGCGTGCGG + Intergenic
1070733197 10:78845829-78845851 GCTGGAGCTGGGATCTCAGGTGG + Intergenic
1070942590 10:80359838-80359860 GCGGGAAATGGGGCCGCGTGTGG - Intronic
1074819615 10:117168398-117168420 GCGCGAACTGGGGGTGCGGGTGG - Intergenic
1074983352 10:118637224-118637246 GCAGGAACTGGGGACTGTGGTGG - Intergenic
1076032704 10:127173109-127173131 GCTGGAGCAGGGGTCTGGGGAGG - Intronic
1076193410 10:128498571-128498593 GAGGGACCTGGAGTCTTGGGAGG - Intergenic
1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG + Intergenic
1077915680 11:6610215-6610237 GTGGGAACTGGTGACACGGGAGG + Exonic
1079112071 11:17610596-17610618 GCGGCAGCTGGGGTCTCTGGGGG - Exonic
1079730597 11:23935073-23935095 GCGGGAACTGGGGCTGCGCGCGG - Intergenic
1080204389 11:29712656-29712678 GCGGGAACTGGGGCTGCGCGTGG + Intergenic
1080384384 11:31802570-31802592 GGGGGGACTGGGGACTGGGGTGG + Intronic
1081115362 11:39192900-39192922 GCGGGAACTGGGGCTGCGCGCGG - Intergenic
1081668830 11:44932145-44932167 GCGGGTGCTGGGGCCTCGGCTGG - Exonic
1083291241 11:61691472-61691494 GCAGGAAGTGGGAACTCGGGCGG - Intronic
1083823009 11:65183047-65183069 GTGGGGAATGGGGTCTGGGGTGG + Intronic
1084186618 11:67476104-67476126 GCGGGAACCGGGGCCGCGCGCGG + Intergenic
1084640079 11:70420649-70420671 GAGGGAACTGGGGGATTGGGGGG - Intronic
1084717886 11:70885116-70885138 AAGAGAACTGGGGTCTCGTGTGG + Intronic
1085636917 11:78166073-78166095 GCAGGAACTAGGGACTAGGGAGG - Intergenic
1086064723 11:82733122-82733144 GCGGGCACTGGGGGCGCGGGAGG - Exonic
1087354507 11:97076612-97076634 GCGGGAACTGGGGCTGCGTGCGG + Intergenic
1087937345 11:104050169-104050191 GGAGGAACTGGGCTCTCGGCAGG + Intronic
1089465041 11:118679561-118679583 GCTGGGACTGGGGTCCCAGGAGG - Exonic
1092472929 12:8794735-8794757 GCGGGAACTGGGGCTGCGTGCGG + Intergenic
1094040180 12:26114140-26114162 GCGGGAACTCCGGTCTAGAGCGG - Intergenic
1095642353 12:44500409-44500431 GCGGGAACTGGGGCTGCGTGTGG + Intergenic
1097181776 12:57175801-57175823 CCGGGCACTGGGGGCTAGGGTGG - Intronic
1097967326 12:65595294-65595316 GCGGGAAGTGGGTTGTAGGGGGG - Intergenic
1100166648 12:91924238-91924260 GCGGGAACCGGGGCTGCGGGTGG - Intergenic
1100277079 12:93081254-93081276 GCCGGGGCTGGGGTCTGGGGTGG - Intergenic
1100679776 12:96907055-96907077 GCGGGAACTGCGGGCCGGGGCGG - Intergenic
1101910562 12:108857648-108857670 GCGGGAGCTGGGGGCGGGGGCGG - Intergenic
1105722144 13:23127583-23127605 GCGGGAACTGGGGCTGCGGGCGG + Intergenic
1105782457 13:23716309-23716331 CCAGGAACTGGGGCCTGGGGTGG - Intergenic
1106335373 13:28778423-28778445 CAGGGAGCTGGGGCCTCGGGGGG + Intergenic
1108435305 13:50396606-50396628 GCGGGAACTGGGGCTGCGCGCGG + Intronic
1110436284 13:75481457-75481479 CCGGGCGCTGGGGCCTCGGGGGG - Exonic
1113937857 13:114004543-114004565 GCGTGAGCTGGGGTCGCAGGTGG - Intronic
1117499035 14:56333537-56333559 GAGAGAACTGGGGCATCGGGAGG + Intergenic
1119709850 14:76813670-76813692 GGGGGTGCTGGGGTGTCGGGGGG - Intronic
1120215769 14:81679521-81679543 GCGGGAACCGGGGCTTCGTGGGG - Intergenic
1122893584 14:104744223-104744245 GGGGGAGCAGGGGTCCCGGGGGG + Intronic
1123039955 14:105486440-105486462 GCGGGGGCTGGGGTTTCGGCCGG - Intergenic
1202929572 14_KI270725v1_random:26128-26150 CTGGGAACTGGGGTCTGGGGTGG - Intergenic
1123422729 15:20145095-20145117 CCGGGAACTGAGGTCTGGGGTGG + Intergenic
1123442276 15:20301254-20301276 CCAGGAACTGGGGTCTGGGGTGG - Intergenic
1123531955 15:21151635-21151657 CCGGGAACTGAGGTCTGGGGTGG + Intergenic
1123538295 15:21261449-21261471 CCAGGAACTGGGGTCTGGGGTGG + Intergenic
1123800088 15:23810361-23810383 GATGTAACTGGGGTCTGGGGTGG + Intergenic
1127638927 15:60897040-60897062 GTGGGTCCTGGGGTCTGGGGTGG + Intronic
1127982724 15:64046386-64046408 GCGGGAACGGGGGACGCGGCGGG + Intronic
1131061819 15:89409241-89409263 GCGGGGACTAGGTTCTCGAGAGG + Intergenic
1131310763 15:91287938-91287960 GGAGGAACTGGGGTCTTGGAGGG + Intronic
1132011780 15:98282448-98282470 GCTGGGACTGCGGTCTGGGGTGG + Intergenic
1132044186 15:98549766-98549788 GCGGGAACCGGGGCTGCGGGAGG + Intergenic
1132155858 15:99494957-99494979 GCGGGAACTGGGGCTGCGCGAGG - Intergenic
1132398087 15:101489143-101489165 GGGGGGACTGGGGTCCCGCGTGG - Intronic
1132849927 16:2020343-2020365 GCGGGCAAGGGGGTCTCGGGAGG + Intronic
1133230588 16:4364727-4364749 GCGGGGGCTGGGGAGTCGGGGGG - Intronic
1133259503 16:4538827-4538849 GTGGGGGGTGGGGTCTCGGGAGG + Intronic
1133332960 16:4987772-4987794 GCGGGAGCTGGGGACCAGGGCGG + Intronic
1134849881 16:17470925-17470947 GCGGGGACAGGGGTGTGGGGAGG - Intergenic
1136342641 16:29655005-29655027 GGAGGAACTGGGGCCTGGGGAGG + Intergenic
1136555461 16:31005117-31005139 GAGGGAACTGGGGCCCAGGGAGG - Intronic
1136718936 16:32304296-32304318 CCCGGAACTGGAGTCTGGGGTGG + Intergenic
1136723959 16:32342652-32342674 CCAGGAACTGGGGTCTGGGGAGG + Intergenic
1136772977 16:32857662-32857684 CCGGGAACTGGGGTCTGGGGTGG - Intergenic
1136837309 16:33510560-33510582 CCCGGAACTGGAGTCTGGGGTGG + Intergenic
1136842289 16:33548696-33548718 CCGGGAACTGGGGTCTGGGGTGG + Intergenic
1136862021 16:33710246-33710268 CTGGGAACTGGGGTCTGGGGTGG - Intergenic
1136897637 16:34003857-34003879 CCAGGAACTGGGGTCTGGGGTGG + Intergenic
1138279234 16:55760543-55760565 GCGGTAACTGGGGGCCAGGGTGG + Intergenic
1138678802 16:58670641-58670663 GAGGGCAGTGGGGTCTGGGGTGG - Intronic
1140357396 16:74318231-74318253 GCAGGAGCTGGGGTCTGGGAGGG + Intergenic
1142262527 16:89049630-89049652 GCTGGCACTGGGCTCTCGGGAGG + Intergenic
1142263376 16:89052662-89052684 GCTGGCACTGGGGACTCCGGAGG - Intergenic
1203002472 16_KI270728v1_random:175113-175135 CCAGGAACTGGGGTCTGGGGAGG - Intergenic
1203007495 16_KI270728v1_random:213475-213497 CCCGGAACTGGAGTCTGGGGTGG - Intergenic
1203075402 16_KI270728v1_random:1119772-1119794 CCGGGAACTGGGGTCTGGGGTGG - Intergenic
1203123512 16_KI270728v1_random:1558429-1558451 CCAGGAACTGGGGTCTGGGGAGG - Intergenic
1203134077 16_KI270728v1_random:1711519-1711541 CCAGGAACTGGGGTCTGGGGAGG - Intergenic
1203147488 16_KI270728v1_random:1810839-1810861 CCCGGAACTGGGGTCTGGGGTGG + Intergenic
1203152454 16_KI270728v1_random:1848993-1849015 CCGGGAACTGGGGTCTGGGGTGG + Intergenic
1142696595 17:1637289-1637311 GCGGAAACTGAGGCCTAGGGAGG - Intronic
1143099752 17:4498735-4498757 CCGGGGACTGGGGGCCCGGGCGG - Intergenic
1143283328 17:5771256-5771278 GCGGGAACTGGGGCTGCGCGCGG + Intergenic
1145193327 17:20866861-20866883 CCAGGAACTGGGGCCTGGGGTGG + Intronic
1145298693 17:21614220-21614242 CCAGGAACTGGGGCCTGGGGTGG - Intergenic
1145351586 17:22089070-22089092 CCAGGAACTGGGGCCTGGGGTGG + Intergenic
1145403746 17:22568875-22568897 CCAGGAACTGGGGCCTGGGGTGG + Intergenic
1146846449 17:36184148-36184170 GCTGGGACTGGGGTGTGGGGAGG + Intronic
1147000421 17:37358773-37358795 GAGAGGTCTGGGGTCTCGGGAGG - Intronic
1148029152 17:44608152-44608174 GGGGCAACTGGGGTATGGGGAGG - Intergenic
1149865746 17:60150134-60150156 GCGGGAGCTGGGGGCACGGAGGG - Intronic
1151699955 17:75737713-75737735 GCGGGGACTGGGGACCCTGGTGG - Intronic
1152046159 17:77937192-77937214 GTGGGTACTGGGGTCTCCAGGGG - Intergenic
1152880580 17:82812449-82812471 GGGGGCTCTGGGGTCTGGGGAGG - Intronic
1152921380 17:83068196-83068218 GCGGCAGCGGGGGTCCCGGGAGG + Intergenic
1152921394 17:83068230-83068252 GCGGCAGCGGGGGTCCCGGGAGG + Intergenic
1152921432 17:83068332-83068354 GCGGCAACGGGGGTCCCGGGAGG + Intergenic
1152921468 17:83068434-83068456 GCGGCAACGGGGGTCCCGGGAGG + Intergenic
1152921506 17:83068536-83068558 GCGGCAACGGGGGTCCCGGGAGG + Intergenic
1152921557 17:83068672-83068694 GCGGCAGCGGGGGTCCCGGGAGG + Intergenic
1152921599 17:83068777-83068799 GCGACAACGGGGGTCCCGGGAGG + Intergenic
1152921627 17:83068846-83068868 GCGGCAGCGGGGGTCCCGGGAGG + Intergenic
1154057279 18:11023994-11024016 GCGGGAACTGGGGCTGCGCGTGG - Intronic
1154334515 18:13455082-13455104 GCAGGAGCTGGGGGCTGGGGAGG + Intronic
1155054559 18:22171997-22172019 GCGGGCAGTGGGGGCGCGGGAGG + Exonic
1156338018 18:36187129-36187151 GCGGGAACCGGCGTCTGGCGGGG - Intergenic
1156447220 18:37246406-37246428 CTGGGGACTGGGGGCTCGGGAGG - Intronic
1157728907 18:49987138-49987160 TTGGGAACTGGGATCTCGGAAGG - Intronic
1158579747 18:58671359-58671381 GCGGGACCTTGGGCCTCGAGGGG - Intergenic
1160768949 19:821849-821871 GGGAGAACTGGGGTTCCGGGCGG + Intronic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161469017 19:4447201-4447223 GCAGGGACTGGGGTCCTGGGCGG - Intronic
1161494310 19:4579281-4579303 GCGAGGACTGAGGTCTCAGGGGG + Intergenic
1161522179 19:4730828-4730850 GCAGGAACTGGGGTCCAGGTAGG - Intergenic
1162632736 19:11941643-11941665 GCGGGAACTGGGGCTGCGCGCGG - Intronic
1163003251 19:14382007-14382029 GCAAGAACTGGGGTCTCTGGGGG - Intronic
1163441205 19:17323572-17323594 GAGGGCGCTGGGGTCTCGAGGGG + Exonic
1165402820 19:35612815-35612837 GCGGGAACTGGGTTGCTGGGCGG + Exonic
1165403860 19:35618393-35618415 CCGGGGCCTGGGGTCTGGGGTGG - Exonic
1165797205 19:38526212-38526234 GGGGTAAGTGGGGTCCCGGGAGG - Intronic
1166314011 19:41978568-41978590 GCGGGCTCTGGGGTCCCTGGAGG - Intronic
1166326045 19:42051812-42051834 GCAGGAGCTGGGGTTTTGGGAGG - Intronic
1166358786 19:42243041-42243063 CCGGGAAATGGAGTCTCAGGTGG + Intronic
1167079834 19:47271274-47271296 GCAGGAGCTGGGATCTCGGGTGG - Exonic
1167676201 19:50887691-50887713 TGGGGACCTGGGGTCTGGGGAGG - Intergenic
1167838727 19:52096266-52096288 CAGGGAACTGGGATCTCGGTGGG + Intergenic
1167964658 19:53133129-53133151 CCGGGAACTGGGATTTCGGTGGG + Intronic
1168317613 19:55490893-55490915 CCGGGAACTGGGCTGTGGGGGGG + Exonic
1202692553 1_KI270712v1_random:101865-101887 GCAGGAACTGGGGTCTGGGGTGG + Intergenic
925776543 2:7341070-7341092 GAGGGACCTGGGGTCTAGCGAGG + Intergenic
926594621 2:14776888-14776910 GTGGGAACTGTGGACTCTGGAGG - Intergenic
927954867 2:27201185-27201207 GTGGGGGCTGGGGTCTCTGGGGG - Intronic
927958037 2:27222225-27222247 GCGGGAACAGGGGTCTCTGCTGG + Exonic
928309549 2:30198008-30198030 GTGGAAACTGGGGTCTAGAGAGG - Intergenic
928365300 2:30695884-30695906 GCTGGAACTGCTGTCTTGGGAGG - Intergenic
930976078 2:57463297-57463319 CCAGGGACTGGGGGCTCGGGGGG - Intergenic
933415792 2:81985187-81985209 GCGGGAACCGGGGTTGTGGGAGG + Intergenic
933917605 2:87011982-87012004 GAGGGAACTGAGGTCTTGGGGGG - Intronic
933953850 2:87352106-87352128 GCAGGAACTGGGGTCTGGGGTGG - Intergenic
934005391 2:87757935-87757957 GAGGGAACTGAGGTCTTGGGGGG + Intronic
934238050 2:90248352-90248374 GCAGGAACTGGGGTCTGGGGTGG - Intergenic
934275149 2:91568384-91568406 GCAGGAACTGGGGTCTGGGGTGG + Intergenic
934322178 2:91980902-91980924 CCGGGAACTGGTGTCTGGGGTGG - Intergenic
934460466 2:94211688-94211710 CCGGGAACTGGGGTCTGGGGTGG - Intergenic
935595165 2:104872544-104872566 GCGGGAACTCGGGGACCGGGAGG - Intergenic
935768349 2:106392026-106392048 GAGGGAACTGAGGTCTTGGGGGG + Intronic
937181104 2:119996995-119997017 GCGGGAACTGGGGCTGCGCGCGG + Intergenic
937716283 2:125037347-125037369 GCGGGAGCTGGGGCTTCGAGCGG + Intergenic
938118815 2:128619873-128619895 GGGGGAACTGAGGCCTGGGGCGG + Intergenic
938318333 2:130345445-130345467 GCGGGAACTGGGGTCTCGGGAGG - Exonic
938786806 2:134637249-134637271 GAGGGAACTGGAGTCTCCAGAGG - Intronic
941700997 2:168604551-168604573 GCTGGAAGTGGGGCCTGGGGAGG + Intronic
946329819 2:219002725-219002747 GCGGGAACTTAGGGCCCGGGAGG - Intergenic
946575022 2:221065760-221065782 GAGGAAACTGGGGTCCAGGGAGG - Intergenic
1169386904 20:5157476-5157498 GCGGGACCTGGGGCCTGGGCAGG + Intronic
1170519610 20:17170252-17170274 GAGGGAACTGAGGTCTAGAGAGG + Intergenic
1171121042 20:22568878-22568900 GCGGGGACTGGGGGCTCGGCCGG + Intergenic
1171561889 20:26134355-26134377 CCAGGAACTGGGGCCTGGGGTGG + Intergenic
1172658111 20:36549260-36549282 GCGGGGGCTGGGGTGTCAGGGGG - Exonic
1173148257 20:40544037-40544059 GCAGGAAGTGGTGTCTCAGGTGG - Intergenic
1174361055 20:50029270-50029292 GCTGGAACAGGTGTCTCTGGAGG + Intergenic
1175789593 20:61732991-61733013 GTGGGAGCTGGGGTCTAGAGGGG - Intronic
1176591598 21:8654727-8654749 CTGGGAACTGGAGTCTGGGGTGG - Intergenic
1176649421 21:9531279-9531301 CCAGGAACTGGGGCCTGGGGTGG - Intergenic
1178398706 21:32265343-32265365 GCGGGAACTGGGGCTGCGTGTGG + Intergenic
1179304778 21:40144355-40144377 GCAGGGCCTGGGGTCTCGGGTGG - Intronic
1180274444 22:10631839-10631861 CTGGGAACTGGGGTCTGGGGTGG - Intergenic
1180548928 22:16526816-16526838 CCAGGAACTGGGGTCTGGGGTGG - Intergenic
1181355781 22:22295067-22295089 CCGGGAACTGGGGTCTGGGGTGG + Intergenic
1181891331 22:26066326-26066348 GAGGGAGGTGGGGTCTCGGGTGG - Intergenic
1182093058 22:27609183-27609205 GCAGGAGCTGGGGGCTAGGGAGG - Intergenic
1182319585 22:29470092-29470114 GCAGAAACTGAGGTCTGGGGAGG + Intergenic
1182685563 22:32120117-32120139 CCAGGAACTGGGGCCTGGGGTGG + Intergenic
1182697570 22:32206977-32206999 CCAGGAACTGGGGCCTGGGGTGG - Intergenic
1183273400 22:36875970-36875992 GCTGGAAGTGGGGTGTGGGGTGG - Exonic
1183606980 22:38871837-38871859 GCGGGCACCGGGGCCTGGGGTGG - Intronic
1184265295 22:43343124-43343146 GCGGGCGCGGGGGGCTCGGGCGG - Intronic
1184778092 22:46633245-46633267 GCTGGCACTGGGGTCAGGGGAGG - Intronic
1185089507 22:48757789-48757811 CCTGGGACTGGGGTCTCTGGGGG + Intronic
953388472 3:42520735-42520757 GGGGAAACTGGGGTCCAGGGAGG - Intronic
955294173 3:57720149-57720171 GCTGGAACTTGGATCTTGGGAGG + Intergenic
964064032 3:152559448-152559470 GCGGGAACTGGGGCTGCGCGTGG + Intergenic
964375021 3:156041331-156041353 GCGGGAACCGGGGCCGCGCGCGG + Intronic
964378499 3:156073173-156073195 GCGGGAACCGGGGCTGCGGGCGG + Intronic
964802917 3:160574292-160574314 GCGGGAACTGGGGCAGCGGGTGG - Intergenic
967448468 3:189596136-189596158 GCGGGAACTGGGGCTGCGCGCGG + Intergenic
968149687 3:196327400-196327422 CTGGGAACTGGGCTCTGGGGAGG - Exonic
968673046 4:1862636-1862658 GCGGGAACCGGGGCCTGGGACGG + Intergenic
969621918 4:8282954-8282976 GTGGGAACCGGGGGCTCGGGAGG + Intronic
969886134 4:10217208-10217230 GCTGCAAATGGGGTCTGGGGTGG + Intergenic
969935993 4:10681779-10681801 GCAGGAGCTCGGGGCTCGGGTGG + Intronic
971280565 4:25239580-25239602 GCGGGAACTGGGGTTGCGTGTGG - Intronic
975420441 4:74158081-74158103 GCGAGGACTGGAGTCGCGGGAGG + Intronic
978536108 4:109765513-109765535 GAGGGAACTGGGGTCCAGTGAGG + Intronic
979755839 4:124339066-124339088 GCGGGAACCGGGGTTGCGCGCGG + Intergenic
981064537 4:140468973-140468995 GAGGGAACTGGAGACTCAGGTGG - Intronic
982985726 4:162203601-162203623 GCGGGAACCGGGGTGGCGCGCGG + Intergenic
983205083 4:164902969-164902991 CCTGGAACTGTGGTCTCGTGGGG + Intergenic
985565126 5:611867-611889 GCGGGTGCTGGGGTGTCTGGAGG + Intergenic
987156824 5:15096903-15096925 GCGGGAACTGGGGCTGCGGGGGG - Intergenic
988073452 5:26324434-26324456 GCGGGAACCGGGGCCGCGCGCGG + Intergenic
990467833 5:56086511-56086533 GCGGGAAGTGGGGGCGGGGGAGG - Intergenic
990553793 5:56909898-56909920 GCGGGGACTGAGGCCTCGGAGGG + Intronic
992837479 5:80654914-80654936 GCGGGAGCTGGGGGCGCTGGGGG - Exonic
994509875 5:100689214-100689236 GCGGGAACTGGGGCTGCGTGTGG - Intergenic
995732989 5:115265434-115265456 TGGGGAACTGGGGTCTCAGCCGG - Intergenic
996322838 5:122238747-122238769 GCGGGGACTGTTGTGTCGGGGGG - Intergenic
999246333 5:150156874-150156896 ACTGGAATAGGGGTCTCGGGTGG - Intergenic
1000085837 5:157886869-157886891 GCGGGAACTGGGGCTGCGCGTGG + Intergenic
1000892563 5:166816777-166816799 GCGGGGGCTGGGGTCGGGGGCGG + Intergenic
1001953029 5:175829440-175829462 GCAGGAACTGGGGTCAGGTGTGG - Intronic
1003261528 6:4521122-4521144 GAGGGAAGTGGGGTCTCAGAGGG - Intergenic
1003578009 6:7315234-7315256 GCGGGAACTGGGGTTACGCGCGG + Intronic
1004196618 6:13511377-13511399 GCGGGAACCGGGGTTGCGCGCGG - Intergenic
1004382293 6:15143026-15143048 GCGGGACCTGGGTTCTCTGTGGG - Intergenic
1004452420 6:15759105-15759127 GCGGGAACTGGGGCTGCGCGTGG - Intergenic
1004861406 6:19807315-19807337 GCGGGAACTGGGGCTGCAGGTGG - Intergenic
1005302691 6:24486398-24486420 GAGGGAACTGAGGTCTAGAGAGG - Intronic
1005596245 6:27381405-27381427 GCGGGAACTGGGGCTGCGCGCGG - Intronic
1007072671 6:39048670-39048692 GCGGGCCCAGGGGTCTCTGGCGG + Intergenic
1013963475 6:115928386-115928408 GCGGGAACTGGGGCTGCGCGTGG - Intergenic
1014055853 6:117014774-117014796 GCGGGAACTGGGGCTACGCGCGG + Intergenic
1018064272 6:160114848-160114870 GCGGGAACTGGGGCTGCGCGCGG - Intergenic
1018129189 6:160712195-160712217 GAGGGAACTGAGGTCTCGGGGGG + Intronic
1018683132 6:166281526-166281548 GCTGCAACTGGGGCCTCAGGGGG - Intergenic
1018734808 6:166679772-166679794 GCGGGAGCTGGGGTTGCGAGTGG + Intronic
1018990338 6:168669159-168669181 GGGGGACCTGGGGTGTGGGGGGG - Intronic
1019198664 6:170296705-170296727 TCGGGATCCGGGGTCTCGGCGGG - Intronic
1019442956 7:1056588-1056610 GCGGGAAGAGGAGGCTCGGGAGG - Intronic
1019484994 7:1285264-1285286 CCGGGCACTGGGGTGTCTGGGGG + Intergenic
1019539492 7:1545416-1545438 GCGGGACCTGGGGTCTCCGAGGG - Exonic
1019607016 7:1915043-1915065 GCAGGAACTGGGGTCTCACTGGG + Intronic
1024465870 7:49711267-49711289 GCGGGAACCGGGGCTGCGGGTGG + Intergenic
1026202915 7:68231062-68231084 GCGGGAACTGGGGCTGCGCGCGG + Intergenic
1029110603 7:98211504-98211526 CCGGGAGCTGGGAACTCGGGTGG + Intronic
1033065052 7:138146177-138146199 GCGGGAACTGGGGCTGCGCGCGG + Intergenic
1034091008 7:148363830-148363852 GCGGGAACTGGGGCTGCGTGCGG + Intronic
1034267572 7:149788651-149788673 GCGGGAACTGGTGAGTGGGGAGG + Intergenic
1034435155 7:151059830-151059852 GGGGGAACTCGGGACTCGAGCGG + Intronic
1034781386 7:153886057-153886079 GCGGGAGCTGGAGTCTGGGAGGG - Intergenic
1035728973 8:1841818-1841840 GCGGGAACTGGGGCCGCGACGGG + Intronic
1035728980 8:1841836-1841858 ACGGGAACTGGGGCCGCGGCGGG + Intronic
1035728987 8:1841854-1841876 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035728994 8:1841872-1841894 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729001 8:1841890-1841912 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729008 8:1841908-1841930 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729013 8:1841926-1841948 GCGGGAACTGGGGCCGCGACCGG + Intronic
1035729034 8:1841980-1842002 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729041 8:1841998-1842020 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729048 8:1842016-1842038 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729055 8:1842034-1842056 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729062 8:1842052-1842074 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1043857128 8:85276075-85276097 GCGGGAAGTGGGGCTGCGGGCGG + Intronic
1044873293 8:96641448-96641470 GAGGCAACTGGGGTCTGGAGCGG - Intergenic
1045323363 8:101098538-101098560 GCGGGAACTGGGGTTCTGGAAGG - Intergenic
1047097671 8:121641537-121641559 GAGGGAACTGGGAGCGCGGGCGG + Intergenic
1047247442 8:123157758-123157780 GCGGGATCTGGGGTCTGCAGTGG - Intergenic
1049697421 8:143990833-143990855 GCGGAGGCTGGGGTCTCGGCCGG - Intronic
1052468232 9:28857430-28857452 GGGGCAACTGGGGTGTAGGGAGG + Intergenic
1053690963 9:40587385-40587407 CCGGGAACTGGGGTCTGGGGTGG - Intergenic
1054273841 9:63050106-63050128 CTGGGAACTGGGGTCTGGGGTGG + Intergenic
1054302223 9:63388356-63388378 CCGGGAACTGGGGTCTGGGGTGG - Intergenic
1054400999 9:64714862-64714884 CTGGGAACTGGGGTCTGGGGTGG - Intergenic
1054434606 9:65199176-65199198 CTGGGAACTGGGGTCTGGGGTGG - Intergenic
1054495784 9:65822505-65822527 CCGGGAACTGGGGTCTGGGGTGG + Intergenic
1055116049 9:72606459-72606481 GGGGGAACTGGGGTCATTGGTGG + Intronic
1056587408 9:87937801-87937823 CCAGGAACTGGGGCCTGGGGTGG + Intergenic
1056609468 9:88115141-88115163 CCAGGAACTGGGGCCTGGGGTGG - Intergenic
1057054165 9:91949035-91949057 GGGGGAAGTGGGGCCCCGGGAGG + Intronic
1057371772 9:94480145-94480167 CCAGGAACTGGGGCCTGGGGTGG - Intergenic
1057383958 9:94591491-94591513 GCGGGAACTGGGGCTGCGTGCGG - Intronic
1060801109 9:126546349-126546371 GCAGGAGCTGGAGTCTCAGGAGG - Intergenic
1061659421 9:132118846-132118868 GAGGAAACTGAGGTCTCTGGAGG - Intergenic
1061836345 9:133332521-133332543 GCGGGAGCTGGGTCCTTGGGCGG - Intronic
1061866220 9:133493003-133493025 GCAGGGACTGGGGGCTGGGGAGG + Intergenic
1062146248 9:134991379-134991401 GCGGGAACTGGGGCTGCGTGCGG - Intergenic
1062162177 9:135086858-135086880 GCGGGGACTGGGGTCTGTGGTGG - Intronic
1062266864 9:135690565-135690587 GTGGGAGGTGGGGTCTAGGGAGG - Intergenic
1203621621 Un_KI270749v1:133491-133513 CTGGGAACTGGGGTCTGGGGTGG - Intergenic
1203627162 Un_KI270750v1:34827-34849 CCAGGAACTGGGGCCTGGGGTGG - Intergenic
1186136999 X:6532704-6532726 GAGGGAAGTGGGGTCCCGTGGGG - Intergenic
1186267286 X:7844594-7844616 GAGGGAAGTGGGGTCCCGTGGGG + Intergenic
1186297703 X:8169057-8169079 GAGGGAAGTGGGGTCCCGTGGGG - Intergenic
1186325156 X:8467414-8467436 GAGGGAAGTGGGGTCCCGTGGGG + Intergenic
1189333902 X:40158441-40158463 GCGGGGAGGGGGGCCTCGGGAGG - Intronic
1190076782 X:47322682-47322704 GCAGGAACTGGCGTCTTGGGAGG + Intergenic
1193804084 X:85972706-85972728 GCGGGAACTGGGGCTGCGCGTGG - Intronic
1195938391 X:110146457-110146479 TAGGGAACTGGGCTATCGGGAGG - Intronic
1197376841 X:125690928-125690950 GCGGGAACCGGGGTTGCGTGCGG - Intergenic
1197488427 X:127084107-127084129 GCTGGAAGTGGGGCCTGGGGAGG - Intergenic
1197719297 X:129734061-129734083 GTTGGAATTGGGGTCTGGGGGGG + Intergenic
1201189664 Y:11436082-11436104 CCGGGAACTGGGGTCTGGGGTGG - Intergenic
1202583980 Y:26405893-26405915 CCAGGAACTGGGGTCTGGGGTGG + Intergenic