ID: 938318412

View in Genome Browser
Species Human (GRCh38)
Location 2:130345795-130345817
Sequence CAGTAGGACCAAAGGGCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938318412_938318421 29 Left 938318412 2:130345795-130345817 CCACCTGCCCTTTGGTCCTACTG 0: 1
1: 0
2: 2
3: 26
4: 235
Right 938318421 2:130345847-130345869 CGGCATGACATCCCAGACCTGGG 0: 1
1: 0
2: 0
3: 1
4: 60
938318412_938318419 9 Left 938318412 2:130345795-130345817 CCACCTGCCCTTTGGTCCTACTG 0: 1
1: 0
2: 2
3: 26
4: 235
Right 938318419 2:130345827-130345849 CGCTGTGCAATGTGGTCATGCGG 0: 1
1: 0
2: 0
3: 5
4: 92
938318412_938318418 1 Left 938318412 2:130345795-130345817 CCACCTGCCCTTTGGTCCTACTG 0: 1
1: 0
2: 2
3: 26
4: 235
Right 938318418 2:130345819-130345841 CTACTTCACGCTGTGCAATGTGG 0: 1
1: 0
2: 0
3: 5
4: 87
938318412_938318420 28 Left 938318412 2:130345795-130345817 CCACCTGCCCTTTGGTCCTACTG 0: 1
1: 0
2: 2
3: 26
4: 235
Right 938318420 2:130345846-130345868 GCGGCATGACATCCCAGACCTGG 0: 1
1: 0
2: 1
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938318412 Original CRISPR CAGTAGGACCAAAGGGCAGG TGG (reversed) Exonic
900645747 1:3707923-3707945 CAGGAGGAGCATCGGGCAGGAGG + Intronic
900875664 1:5340819-5340841 CAGCAGGAACAAAGGGCAGCAGG + Intergenic
901069539 1:6510215-6510237 CAGGAGAGCCAGAGGGCAGGGGG - Intronic
904604562 1:31691597-31691619 CATTGGGCCCAAAGGGCAGAAGG - Exonic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905870594 1:41402016-41402038 CACTATGACCACAGGGCTGGAGG - Intergenic
906524531 1:46486460-46486482 AAGTTGGACCAAGGGGGAGGTGG - Intergenic
909569726 1:77095564-77095586 CAATATGACAAAAGGGTAGGGGG + Intronic
909581972 1:77246791-77246813 CAGAAGGACCAAAAGAGAGGTGG + Intergenic
909929397 1:81478166-81478188 AAATAGGAGCAAGGGGCAGGAGG + Intronic
912144746 1:106779641-106779663 CAGTAGGAACAAAGATGAGGTGG - Intergenic
912622544 1:111177848-111177870 CAATAGGATGAAGGGGCAGGGGG - Intronic
915494015 1:156268222-156268244 CAGTAGGACCATAGGGACTGCGG - Intronic
915591690 1:156874548-156874570 CTGTAGGGACACAGGGCAGGAGG - Intronic
915668339 1:157465338-157465360 GAGCAGGGCCAAGGGGCAGGGGG - Intergenic
916059045 1:161086525-161086547 CTGCAGGACCAAAGGGCAAGTGG - Intronic
916421883 1:164645347-164645369 CAGAAGGACCAGAGAGCAAGGGG - Intronic
916658337 1:166897921-166897943 CAGTTGGTCAAAAGTGCAGGTGG + Intergenic
917556134 1:176090556-176090578 CAGCAGCAGCACAGGGCAGGGGG + Intronic
917929169 1:179812187-179812209 CATTGGGACCAAGGGGCAGGAGG - Intronic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
918189894 1:182163967-182163989 CAGCAGGACAAGAGGTCAGGAGG + Intergenic
920960110 1:210656416-210656438 CAAGAGGCTCAAAGGGCAGGGGG - Intronic
921235681 1:213125917-213125939 CAATAACACCAAAGGGCAAGCGG - Intronic
923946401 1:238892973-238892995 CAGTGGGACAAACTGGCAGGAGG - Intergenic
924931571 1:248737121-248737143 AAGTAGGACCAGAGCCCAGGAGG - Intronic
1065068702 10:22000552-22000574 CAGTAAGCACAAAGGCCAGGAGG - Intronic
1065862091 10:29880429-29880451 AAGTAGGAAAAAAGGGAAGGGGG + Intergenic
1066237502 10:33500769-33500791 CAGTAGGACGAAAAGAGAGGTGG - Intergenic
1066285909 10:33965949-33965971 CAGTAGGACCTAGAGACAGGTGG - Intergenic
1067092255 10:43273821-43273843 CAGTTGGTCAAAAGTGCAGGTGG - Intergenic
1068393967 10:56437124-56437146 CAGAAGGACAGAAGGGTAGGAGG + Intergenic
1068915911 10:62431218-62431240 AAGTAGGAAGAAAGAGCAGGGGG - Intronic
1069639230 10:69944156-69944178 CAGCGGGACCAAAGGGCGAGAGG + Exonic
1070148544 10:73791836-73791858 CTGTGGGAACAAGGGGCAGGAGG - Intronic
1070367826 10:75753260-75753282 AAGTAGTACCTAAGGGCAGTGGG + Intronic
1071602072 10:86963171-86963193 CAGAAGGACCAGAGGGTGGGTGG - Exonic
1072564767 10:96608289-96608311 CAGAAGGAGCAAGGGACAGGTGG - Intronic
1072787425 10:98293760-98293782 CAGGAGGAGAAAAGGCCAGGTGG + Intergenic
1072882413 10:99240787-99240809 TAGTAGAAGGAAAGGGCAGGCGG - Intergenic
1073295337 10:102435267-102435289 AAGCAGTACCAAAGGGCAGTGGG - Intergenic
1075567364 10:123514405-123514427 CAGTAAGACCCAAGGGCCTGAGG + Intergenic
1076823411 10:132953682-132953704 CAGTAGTTCCAAAAGGGAGGAGG + Intergenic
1077095196 11:796159-796181 GAGCAGGACCAGCGGGCAGGTGG - Exonic
1077358994 11:2132226-2132248 CAGTAAGACCAAAGGAGGGGAGG - Intronic
1078656753 11:13247620-13247642 CAGTAGGTACAAAGGGCACTGGG - Intergenic
1079071526 11:17351896-17351918 CGGTAGAAACCAAGGGCAGGGGG - Exonic
1079660912 11:23035563-23035585 CAGCAGGACGGAAGGGGAGGTGG - Intergenic
1083356312 11:62068910-62068932 CAGTAGGAGCAAAGGCCCCGAGG + Intergenic
1084221565 11:67683637-67683659 CAGTAAGTCCAAAAGGGAGGAGG - Intergenic
1084486357 11:69450474-69450496 CAGGAGGCCCACAGGGCTGGGGG - Intergenic
1086989741 11:93289925-93289947 CAGTTATATCAAAGGGCAGGAGG + Intergenic
1087696913 11:101389781-101389803 CAGTATGACCAAAGCACAGAAGG - Intergenic
1088832291 11:113547661-113547683 CAGTAGGACAAGTGGGAAGGTGG - Intergenic
1089636752 11:119819206-119819228 CAGTAGGAGAAATTGGCAGGTGG + Intergenic
1089935870 11:122363460-122363482 CTGTAAGACCAAATGGAAGGAGG - Intergenic
1091230237 11:133983643-133983665 AAGTAGACCCAGAGGGCAGGGGG - Intergenic
1096252528 12:50042201-50042223 CAGGAGGACATAAGGGTAGGAGG - Intergenic
1097901189 12:64875296-64875318 CAGCAAGACCAATGGGCTGGGGG + Exonic
1098040784 12:66352371-66352393 CAGCAGGTGCAAAGGCCAGGAGG + Intronic
1100227658 12:92575067-92575089 CAGGAAGTCCAAAGGGCAAGGGG - Intergenic
1100743298 12:97618868-97618890 CAGTAGGAGCAAAGTCAAGGAGG - Intergenic
1101192706 12:102351685-102351707 CTCTAAGACCCAAGGGCAGGAGG - Intergenic
1101336614 12:103802366-103802388 CAGCAGGAGCAAATGCCAGGTGG + Intronic
1101416554 12:104513576-104513598 CTGTAACACCAAAGGGCAGGAGG + Intronic
1101575304 12:105991695-105991717 CAGCATGAACAAAGGCCAGGGGG + Intergenic
1101889895 12:108703844-108703866 CAGGAGGAACAAGGGGCTGGAGG - Intronic
1103890729 12:124237247-124237269 CAGTAGCCCCACAGGGCTGGTGG - Intronic
1103939304 12:124493171-124493193 CAGTTGGGGCAAAGGGCAGGAGG + Intronic
1106548293 13:30749630-30749652 TAGGAGCTCCAAAGGGCAGGAGG - Intronic
1108271223 13:48761392-48761414 CAGAAGCACCAAAGGGAATGGGG - Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114536203 14:23424595-23424617 CAGGAGGAGGAAAGGGCAGAGGG - Intronic
1115556958 14:34551479-34551501 AAGTAGCACCAAAGGGCCGGGGG - Intergenic
1118749230 14:68794458-68794480 CAGTCGGGCCAAGGCGCAGGGGG - Intronic
1118995939 14:70836080-70836102 CAGTTGGTCAAAAGTGCAGGTGG + Intergenic
1119099722 14:71868768-71868790 CAGTAGGACGAGAGGCCAAGGGG - Intergenic
1121538245 14:94706096-94706118 CAATAGGAGCAATGGGCAGGGGG - Intergenic
1121637718 14:95465158-95465180 GAGAAGGATTAAAGGGCAGGAGG + Intronic
1122518687 14:102327108-102327130 CAGCAGGAACAAGGGGCAGGGGG + Intronic
1122645309 14:103189691-103189713 CCGTCGGACCCCAGGGCAGGTGG + Intergenic
1122660831 14:103293816-103293838 CAGCAGGGGCAAAGGCCAGGAGG - Intergenic
1124678674 15:31710530-31710552 CAGCAAGACCTCAGGGCAGGGGG + Intronic
1125301039 15:38253105-38253127 CAGCAGCACCGAGGGGCAGGAGG - Exonic
1126313245 15:47340093-47340115 CATTAGGAGCAAAGGCCATGAGG + Intronic
1126350669 15:47742057-47742079 CAACAGGAGCCAAGGGCAGGAGG + Intronic
1126951314 15:53884813-53884835 CAGTAGGAGTAAAGGGAAAGAGG - Intergenic
1127714938 15:61640753-61640775 CAGAAGGGGCAAAGGGCAGGAGG + Intergenic
1128844123 15:70874319-70874341 CAGGAGGTACAAAGGGCAGGTGG + Intronic
1128982717 15:72198536-72198558 CTGTAGTGCCAAAGGGCTGGGGG - Intergenic
1129949185 15:79571201-79571223 CAGGAGCACAAAAGGGCAAGTGG - Intergenic
1130074456 15:80676645-80676667 CAGTAATTCCAAAAGGCAGGAGG - Intergenic
1133075639 16:3278921-3278943 GAGTAGGATCAAAGAGCATGTGG + Intronic
1134650509 16:15904784-15904806 CAGAGTGACCAAAGAGCAGGTGG - Intergenic
1135413326 16:22251019-22251041 CAGCAGGAACAAAATGCAGGAGG - Intronic
1135678909 16:24440371-24440393 CAGTAGCAAGAAGGGGCAGGTGG + Intergenic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1139120458 16:64009852-64009874 CAAGAGTACCATAGGGCAGGTGG - Intergenic
1139449143 16:67016321-67016343 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
1140408277 16:74725343-74725365 CAGACAGACCACAGGGCAGGTGG + Intronic
1141634035 16:85304306-85304328 CAGGAGAAGAAAAGGGCAGGAGG - Intergenic
1141838666 16:86559977-86559999 CAGCAGGCCCAAAGGCCATGCGG + Intergenic
1142287003 16:89175551-89175573 TGGGAGGACCAAAGGGGAGGGGG + Intronic
1142670346 17:1485132-1485154 CAGTAGGACCCAGAGGCAGCTGG - Intronic
1144189787 17:12833992-12834014 CAGTAGCGCCAAAAGGGAGGAGG + Intronic
1144580693 17:16457441-16457463 CAGCAAGACCAGAGGGCAGGAGG + Intronic
1144851965 17:18248388-18248410 CAGTATGAGCAAAGGTCTGGAGG - Intronic
1146450020 17:32965410-32965432 CAGGAAGATCAAGGGGCAGGAGG + Intergenic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1146910464 17:36645433-36645455 GGGTAGGACCAGAGGGGAGGGGG - Intergenic
1150077628 17:62206735-62206757 CAGGGGCACCAAAGGGCAGCTGG - Intergenic
1151172581 17:72259744-72259766 CAGCAGGGCCAACGGGAAGGTGG - Intergenic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1151875242 17:76864261-76864283 CAGCAGGACCCAGGGGCAGGGGG + Intergenic
1152813571 17:82393855-82393877 CAGAGGCACCAAAGGACAGGGGG + Intronic
1154338083 18:13481913-13481935 CAGAAGGCTCACAGGGCAGGAGG + Intronic
1157190980 18:45581280-45581302 CTGCAGGAACAAAGGACAGGTGG + Intronic
1161408450 19:4103079-4103101 GAGTAGGACCAGGGGCCAGGGGG + Intronic
1161584472 19:5097729-5097751 CAGAAGAACAAAAGGGAAGGTGG - Intronic
1161874603 19:6898329-6898351 AATTAGGACCACAGGGCTGGGGG - Intronic
1162813158 19:13176888-13176910 CGGCAGGAGCAAAGGCCAGGAGG + Intergenic
1164515768 19:28934059-28934081 CAGCAGGAACACAAGGCAGGAGG - Intergenic
1165655846 19:37531555-37531577 CAGTGGGAACAAAGGCCGGGGGG - Intronic
1165979445 19:39707247-39707269 CAGGATGACCAAAGTGCAGTCGG - Exonic
1166164439 19:40977483-40977505 CAGCAAGAGGAAAGGGCAGGAGG - Intergenic
1166186339 19:41141565-41141587 CAGCAAGAGGAAAGGGCAGGAGG + Intergenic
1166213505 19:41321750-41321772 CAGCAGCACCAAGGGGCAGAAGG + Intronic
1166768517 19:45266381-45266403 CAGGAGGAGAAAAGGGCTGGAGG - Intronic
1167019214 19:46861410-46861432 GGGCAGGTCCAAAGGGCAGGAGG - Intergenic
1167125275 19:47544943-47544965 CAGGAGGCCCAGAAGGCAGGCGG - Exonic
1167305838 19:48708827-48708849 CAGCAGGGATAAAGGGCAGGAGG + Intergenic
925227660 2:2199682-2199704 CAGTAAGACCCAAGGTGAGGAGG - Intronic
926207468 2:10844268-10844290 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
926826096 2:16906303-16906325 CAGAATCACCAAAGGGGAGGTGG - Intergenic
926888463 2:17618914-17618936 CAGTAGGACCAAAGTGCTGGGGG - Intronic
929572124 2:43029250-43029272 CAGGAGGACCCAAGGCCAGGAGG + Intergenic
930224114 2:48774859-48774881 CAGAATTACAAAAGGGCAGGAGG - Intronic
930704654 2:54492531-54492553 CAGTTGGTGCAAAGGGCAGTAGG - Intronic
932365989 2:71153946-71153968 CAGTTGGACCGAAAGGAAGGGGG - Intergenic
932406396 2:71515592-71515614 CAGAAGGAGGAAAGAGCAGGAGG - Intronic
933939501 2:87233635-87233657 TAGAAGGACAAAAGAGCAGGAGG - Intergenic
936353634 2:111732138-111732160 TAGAAGGACAAAAGAGCAGGAGG + Intergenic
937472729 2:122187991-122188013 CAGTAGGAGCAAACACCAGGAGG + Intergenic
938318412 2:130345795-130345817 CAGTAGGACCAAAGGGCAGGTGG - Exonic
939176695 2:138757390-138757412 GAGGAGGACCCAAGGGAAGGTGG - Intronic
939355447 2:141095759-141095781 AAGCAAGACCAAAGGGCAGCTGG - Intronic
940904270 2:159154556-159154578 CAGTTGAAACAAGGGGCAGGAGG - Intronic
943099746 2:183473427-183473449 CAGGAGGACCAAAAGGGAGTAGG + Intergenic
945974476 2:216259556-216259578 CTGGAGGATCAAAAGGCAGGAGG - Exonic
947126150 2:226870429-226870451 AAGTAGGAGCAAAGGGAAGTAGG - Intronic
947519811 2:230836857-230836879 CAGTGGCAGCAAAGTGCAGGGGG - Intergenic
947791349 2:232871112-232871134 GAGTTGGACCAAAGGGCAGCTGG + Intronic
948487747 2:238291499-238291521 CTGGAGGGCCAAAGGACAGGCGG + Intergenic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
1169745817 20:8941655-8941677 CAGTAGGAACAAATGCAAGGTGG + Intronic
1169794956 20:9452024-9452046 CAGTGGGAACAAAGGCTAGGTGG - Intronic
1170876819 20:20257672-20257694 TAGTAGTACAAAAGGACAGGTGG + Intronic
1172134779 20:32679643-32679665 CAGTGGGAGCTAAGGGGAGGAGG - Intergenic
1173774759 20:45695152-45695174 CAGTAGATCAAAAGTGCAGGAGG + Intronic
1174118078 20:48241639-48241661 CAGGAGGACAACAGGGCAGGAGG - Intergenic
1175114588 20:56673278-56673300 TAGTAGGGCCAAAGGGCAAAGGG - Intergenic
1176097557 20:63351286-63351308 CAGGAGCACAAAAGGGCTGGCGG + Intronic
1176151294 20:63592439-63592461 CAGAAGGGCCTAGGGGCAGGAGG + Intronic
1178474025 21:32920623-32920645 GAGTAGGATGGAAGGGCAGGAGG + Intergenic
1182016419 22:27043960-27043982 AAGAAGGACAAAAGGGAAGGAGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183264010 22:36814681-36814703 CACTAGTACCAGAGGGCTGGGGG + Intronic
1183360921 22:37383086-37383108 CAGCTGTACCCAAGGGCAGGAGG - Intronic
1183455213 22:37918866-37918888 CAGGAGGGGCAGAGGGCAGGAGG - Intronic
1184087703 22:42275150-42275172 CAGTAGGACCAAAAGTCTGCAGG + Intronic
1185119046 22:48954900-48954922 CAGGAGGCCCCAGGGGCAGGGGG - Intergenic
949190623 3:1244545-1244567 AGGTAGGAACAAAGAGCAGGAGG + Intronic
949982492 3:9510530-9510552 CAGTAGGACCATGGGGTAGCTGG - Intronic
950109936 3:10412496-10412518 CAGCAGGAGCAAAGGCCTGGGGG - Intronic
952161754 3:30700848-30700870 CAGTTGGAACAAAGGGGAGGGGG + Intergenic
953768390 3:45761077-45761099 CAGCAGCAGCAAAGGGCAGGTGG - Intronic
954799568 3:53179380-53179402 CAGCAGGAACAAAGGCCTGGAGG + Intronic
956126384 3:66014845-66014867 CAGTGGGAGCAAAGGCCTGGAGG - Intronic
959162521 3:102738757-102738779 CAGTAGGACCAAAAGCCTGCTGG - Intergenic
960203009 3:114860587-114860609 CAGTTAAACCAAAGGGTAGGAGG + Intronic
961829293 3:129615270-129615292 CAGTAGGGCCAATGGACAGTGGG - Intergenic
963071524 3:141308907-141308929 CAGTGGGACAAAAGGGCAGCTGG - Intergenic
963234945 3:142947316-142947338 CAGGAGGAGGAAGGGGCAGGCGG + Intergenic
964708861 3:159649840-159649862 TAGTAGGACCAAAGTGGAGGGGG + Intronic
964827055 3:160840111-160840133 CAGTAGGAACAAATGGTAAGTGG + Intronic
967330441 3:188284438-188284460 CAGGAGGCCCAAGGGGGAGGTGG + Intronic
975296326 4:72738487-72738509 CAGTAGCTACAAAGGGCTGGGGG - Intergenic
981803210 4:148682015-148682037 CTGAAGGATGAAAGGGCAGGTGG + Intergenic
985502308 5:256397-256419 CAGTAGGAGCGAATGGCTGGCGG - Exonic
985734717 5:1572218-1572240 CAGTAGGAGCGAATGGCTGGGGG + Intergenic
985825432 5:2187534-2187556 CAGCAGGACCAAAGAACAGTGGG + Intergenic
988716632 5:33835214-33835236 CCGTAAGACCAAAAGGCAGGGGG + Intronic
989180474 5:38571568-38571590 CAGTAGGAGCAAAGGAGAGGAGG - Intronic
992153170 5:73926492-73926514 CAGGTGAACCAAAGGGTAGGGGG - Intronic
992222942 5:74590693-74590715 AAGTAGAAACAAAGGACAGGGGG + Intergenic
992283161 5:75203226-75203248 CAGGAGGCCAAATGGGCAGGAGG + Intronic
992944214 5:81793917-81793939 CAGCAGGTCCAAAGCCCAGGGGG - Intergenic
997405709 5:133645004-133645026 CATTAGGACCAAAGGGACAGGGG - Intergenic
997881879 5:137599006-137599028 CAGTATGTCCACATGGCAGGAGG + Intergenic
999253033 5:150193751-150193773 GAGCATGTCCAAAGGGCAGGTGG - Intronic
1000706844 5:164523176-164523198 CAGTAGGAACAAAGGCATGGAGG + Intergenic
1001089239 5:168725119-168725141 CAGAAGGACTACATGGCAGGAGG + Intronic
1001953911 5:175834983-175835005 CAGGAGGGGCAAAGGCCAGGGGG + Intronic
1003053729 6:2801409-2801431 CAGAAGGAGCCAAGGGCTGGCGG + Intergenic
1006402874 6:33827981-33828003 CAGCAGGGGCAAAGGGCAGGTGG - Intergenic
1006446916 6:34084765-34084787 CAGTAGGAACAAAAGCCTGGAGG - Intronic
1006896540 6:37475018-37475040 CAGTAGGAGCAACTGGCAAGGGG + Intronic
1007479480 6:42140954-42140976 CAGTAGAAGCAAAGACCAGGAGG - Intronic
1007515106 6:42404677-42404699 CGGTAGGATCAAGAGGCAGGAGG - Intronic
1007937602 6:45747147-45747169 GTGAAGGACCCAAGGGCAGGAGG + Intergenic
1010756242 6:79669136-79669158 CAGAAGGACCAGCGTGCAGGAGG - Intronic
1012223699 6:96681315-96681337 CAGCAGGAGGAAAGGGCAGTAGG + Intergenic
1015855727 6:137622622-137622644 CTGAAGGACGAAAGGTCAGGGGG - Intergenic
1015914858 6:138205454-138205476 AAGTAGGAACCAAGGGCAGATGG - Intronic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1018890067 6:167976862-167976884 CAGGAAGACCCAGGGGCAGGAGG - Intergenic
1019262058 7:87231-87253 CTGTTGGAGCAATGGGCAGGTGG + Intergenic
1019605678 7:1909050-1909072 CAGTGGGAACACAGGGCAGGAGG + Intronic
1028635668 7:92986461-92986483 CACTAGGAGGAAAGGGTAGGTGG - Intergenic
1028711723 7:93917138-93917160 CAGTATGACCAAATTCCAGGTGG - Intergenic
1029923290 7:104288986-104289008 CAGTAAGGCCAAAGGCTAGGTGG - Intergenic
1030585583 7:111414496-111414518 TAGTAGGAGTAATGGGCAGGAGG + Intronic
1033227989 7:139575856-139575878 CAGAAGGACAAAAGAGCATGAGG - Intronic
1034503443 7:151467292-151467314 CAGTAGGAGGGCAGGGCAGGCGG - Intronic
1034678805 7:152912087-152912109 CTGTGGGGCCCAAGGGCAGGAGG + Intergenic
1035350120 7:158239536-158239558 CAGCAGGACCAATGGGGACGTGG + Intronic
1035372850 7:158390526-158390548 CAGTAGGACCATCGTGCTGGAGG + Intronic
1035583576 8:755597-755619 GAGTAGGAACGAGGGGCAGGTGG + Intergenic
1035640805 8:1183637-1183659 GAGTAAGTCCACAGGGCAGGCGG + Intergenic
1036437576 8:8749261-8749283 TGGGAGGACAAAAGGGCAGGTGG + Intergenic
1036581706 8:10081297-10081319 CAGGAGGCCCAAATGGCACGTGG - Intronic
1037573684 8:20180620-20180642 CAGGAGGTTCAAAGAGCAGGAGG - Intronic
1038103751 8:24410303-24410325 CAGTGGGGCCAAATGGCGGGTGG - Intergenic
1041317053 8:56574922-56574944 CAGTTGGTCCAAAATGCAGGTGG - Intergenic
1041946984 8:63455979-63456001 AAGTAGGACAAAAGGGAAGAAGG - Intergenic
1042918384 8:73897494-73897516 CAGTTGGTCAAAAGGACAGGAGG + Intergenic
1043571061 8:81602696-81602718 CAGGAGGACCACTAGGCAGGGGG + Intergenic
1043735152 8:83731513-83731535 CAGCAGGAGCAAGGAGCAGGTGG - Intergenic
1045414654 8:101953837-101953859 CAGTTGGTCAAAAGTGCAGGTGG + Intronic
1047446774 8:124927202-124927224 CAGTAGGTCATAAGGGCATGCGG - Intergenic
1048639059 8:136332552-136332574 CTGTGGTACCAAAAGGCAGGAGG + Intergenic
1049190467 8:141284768-141284790 AAGAAGGACTGAAGGGCAGGAGG + Intronic
1049433704 8:142576714-142576736 CACCAGGACCCATGGGCAGGTGG + Intergenic
1052391472 9:27883237-27883259 CAGGAGGAAGAAAGAGCAGGCGG - Intergenic
1052971387 9:34379309-34379331 CAGTAGAACCTAAGGTCAGGAGG - Intronic
1053144864 9:35705502-35705524 CATCAGGAACAAGGGGCAGGGGG + Intronic
1053463836 9:38290614-38290636 CAGTAGGAAAAAAGGCCTGGTGG - Intergenic
1053667279 9:40325108-40325130 CTGGAGGATCACAGGGCAGGTGG + Intronic
1054378424 9:64465136-64465158 CTGGAGGATCACAGGGCAGGTGG + Intergenic
1054517331 9:66051175-66051197 CTGGAGGATCACAGGGCAGGTGG - Intergenic
1056830407 9:89912437-89912459 CGTGAGGAGCAAAGGGCAGGGGG + Intergenic
1057326087 9:94065452-94065474 CAGTAGGACTAAAGTGAAGGTGG - Intronic
1057700453 9:97360175-97360197 CAGTAGAGCCAAAGGGAAGAGGG + Intronic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1061995681 9:134181587-134181609 CAGCAGGACCCGTGGGCAGGTGG - Intergenic
1062053200 9:134457760-134457782 CAGGATGACCCCAGGGCAGGAGG - Intergenic
1062056418 9:134471584-134471606 CAGTAGGACCCAGGTTCAGGAGG - Intergenic
1062610018 9:137369427-137369449 CAGGAGGAGCAGAGGGCGGGCGG - Intronic
1186439484 X:9573671-9573693 CACTAGGACCAAACCACAGGTGG - Intronic
1186490450 X:9968219-9968241 CAATAAGACCAACTGGCAGGTGG - Intergenic
1194341621 X:92712847-92712869 CAGTAGTTCCAAAAGGGAGGAGG - Intergenic
1195315132 X:103670020-103670042 CAGAAGGTCAAAAGAGCAGGGGG - Intergenic
1200649970 Y:5829545-5829567 CAGTAGTTCCAAAAGGGAGGAGG - Intergenic