ID: 938320075

View in Genome Browser
Species Human (GRCh38)
Location 2:130356489-130356511
Sequence GCGGGCGGGACAGGTGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938320066_938320075 -7 Left 938320066 2:130356473-130356495 CCGGAACAACCTGGCTGCGGGCG No data
Right 938320075 2:130356489-130356511 GCGGGCGGGACAGGTGGGGCGGG No data
938320061_938320075 6 Left 938320061 2:130356460-130356482 CCTCGTCGCGCTCCCGGAACAAC No data
Right 938320075 2:130356489-130356511 GCGGGCGGGACAGGTGGGGCGGG No data
938320058_938320075 14 Left 938320058 2:130356452-130356474 CCCGGTGTCCTCGTCGCGCTCCC No data
Right 938320075 2:130356489-130356511 GCGGGCGGGACAGGTGGGGCGGG No data
938320056_938320075 22 Left 938320056 2:130356444-130356466 CCCTCGTTCCCGGTGTCCTCGTC No data
Right 938320075 2:130356489-130356511 GCGGGCGGGACAGGTGGGGCGGG No data
938320065_938320075 -6 Left 938320065 2:130356472-130356494 CCCGGAACAACCTGGCTGCGGGC No data
Right 938320075 2:130356489-130356511 GCGGGCGGGACAGGTGGGGCGGG No data
938320057_938320075 21 Left 938320057 2:130356445-130356467 CCTCGTTCCCGGTGTCCTCGTCG No data
Right 938320075 2:130356489-130356511 GCGGGCGGGACAGGTGGGGCGGG No data
938320059_938320075 13 Left 938320059 2:130356453-130356475 CCGGTGTCCTCGTCGCGCTCCCG No data
Right 938320075 2:130356489-130356511 GCGGGCGGGACAGGTGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938320075 Original CRISPR GCGGGCGGGACAGGTGGGGC GGG Intronic