ID: 938328088

View in Genome Browser
Species Human (GRCh38)
Location 2:130427813-130427835
Sequence CCTGGCCTCGGGCTCGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938328088_938328098 7 Left 938328088 2:130427813-130427835 CCTGCGCCGAGCCCGAGGCCAGG No data
Right 938328098 2:130427843-130427865 ACAACTACCTCAACAGCGTGTGG No data
938328088_938328103 28 Left 938328088 2:130427813-130427835 CCTGCGCCGAGCCCGAGGCCAGG No data
Right 938328103 2:130427864-130427886 GGGACTCCATTCGGTCCACAGGG No data
938328088_938328102 27 Left 938328088 2:130427813-130427835 CCTGCGCCGAGCCCGAGGCCAGG No data
Right 938328102 2:130427863-130427885 TGGGACTCCATTCGGTCCACAGG No data
938328088_938328101 19 Left 938328088 2:130427813-130427835 CCTGCGCCGAGCCCGAGGCCAGG No data
Right 938328101 2:130427855-130427877 ACAGCGTGTGGGACTCCATTCGG No data
938328088_938328099 8 Left 938328088 2:130427813-130427835 CCTGCGCCGAGCCCGAGGCCAGG No data
Right 938328099 2:130427844-130427866 CAACTACCTCAACAGCGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938328088 Original CRISPR CCTGGCCTCGGGCTCGGCGC AGG (reversed) Intergenic
No off target data available for this crispr