ID: 938329795

View in Genome Browser
Species Human (GRCh38)
Location 2:130441536-130441558
Sequence TCTGAGATGCAGGTGGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938329786_938329795 14 Left 938329786 2:130441499-130441521 CCTGCTGTCCTCTGGGTAAGGAG No data
Right 938329795 2:130441536-130441558 TCTGAGATGCAGGTGGTGCCAGG No data
938329784_938329795 19 Left 938329784 2:130441494-130441516 CCAGGCCTGCTGTCCTCTGGGTA No data
Right 938329795 2:130441536-130441558 TCTGAGATGCAGGTGGTGCCAGG No data
938329787_938329795 6 Left 938329787 2:130441507-130441529 CCTCTGGGTAAGGAGTGTGCCAC No data
Right 938329795 2:130441536-130441558 TCTGAGATGCAGGTGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938329795 Original CRISPR TCTGAGATGCAGGTGGTGCC AGG Intergenic
No off target data available for this crispr