ID: 938330050

View in Genome Browser
Species Human (GRCh38)
Location 2:130442746-130442768
Sequence GAGAATGGGGAGCACAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938330040_938330050 10 Left 938330040 2:130442713-130442735 CCTGCTGGCTGACACTGGAAAAG No data
Right 938330050 2:130442746-130442768 GAGAATGGGGAGCACAAGGCTGG No data
938330039_938330050 11 Left 938330039 2:130442712-130442734 CCCTGCTGGCTGACACTGGAAAA No data
Right 938330050 2:130442746-130442768 GAGAATGGGGAGCACAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938330050 Original CRISPR GAGAATGGGGAGCACAAGGC TGG Intergenic
No off target data available for this crispr