ID: 938336983 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:130509430-130509452 |
| Sequence | GCCCTTCCTCGGGTGGGCGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 184 | |||
| Summary | {0: 2, 1: 4, 2: 7, 3: 17, 4: 154} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938336983_938337000 | 16 | Left | 938336983 | 2:130509430-130509452 | CCCACGCCCACCCGAGGAAGGGC | 0: 2 1: 4 2: 7 3: 17 4: 154 |
||
| Right | 938337000 | 2:130509469-130509491 | GAAAACACCCAGCCCACCCAAGG | 0: 4 1: 3 2: 3 3: 29 4: 225 |
||||
| 938336983_938337001 | 17 | Left | 938336983 | 2:130509430-130509452 | CCCACGCCCACCCGAGGAAGGGC | 0: 2 1: 4 2: 7 3: 17 4: 154 |
||
| Right | 938337001 | 2:130509470-130509492 | AAAACACCCAGCCCACCCAAGGG | 0: 5 1: 3 2: 0 3: 20 4: 185 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938336983 | Original CRISPR | GCCCTTCCTCGGGTGGGCGT GGG (reversed) | Exonic | ||