ID: 938336983

View in Genome Browser
Species Human (GRCh38)
Location 2:130509430-130509452
Sequence GCCCTTCCTCGGGTGGGCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 2, 1: 4, 2: 7, 3: 17, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938336983_938337000 16 Left 938336983 2:130509430-130509452 CCCACGCCCACCCGAGGAAGGGC 0: 2
1: 4
2: 7
3: 17
4: 154
Right 938337000 2:130509469-130509491 GAAAACACCCAGCCCACCCAAGG 0: 4
1: 3
2: 3
3: 29
4: 225
938336983_938337001 17 Left 938336983 2:130509430-130509452 CCCACGCCCACCCGAGGAAGGGC 0: 2
1: 4
2: 7
3: 17
4: 154
Right 938337001 2:130509470-130509492 AAAACACCCAGCCCACCCAAGGG 0: 5
1: 3
2: 0
3: 20
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938336983 Original CRISPR GCCCTTCCTCGGGTGGGCGT GGG (reversed) Exonic