ID: 938337165

View in Genome Browser
Species Human (GRCh38)
Location 2:130510430-130510452
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 2, 1: 0, 2: 5, 3: 8, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938337160_938337165 11 Left 938337160 2:130510396-130510418 CCACTGGCATGCAATAGGGTCAA 0: 6
1: 0
2: 0
3: 8
4: 81
Right 938337165 2:130510430-130510452 CTGTGTCCACGCCGGCAAGAGGG 0: 2
1: 0
2: 5
3: 8
4: 76
938337156_938337165 27 Left 938337156 2:130510380-130510402 CCTGGGGGGCTCTGCTCCACTGG 0: 6
1: 0
2: 1
3: 23
4: 220
Right 938337165 2:130510430-130510452 CTGTGTCCACGCCGGCAAGAGGG 0: 2
1: 0
2: 5
3: 8
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900145578 1:1157519-1157541 CCGTTTCCACCCCGGCAGGAAGG - Intergenic
904507491 1:30970322-30970344 CACTGTCCACACTGGCAAGAAGG + Intronic
907078509 1:51599922-51599944 CTGTGTCCTCACCTGGAAGAAGG + Intronic
910551995 1:88486046-88486068 CTGTGTCCACCCAGGCAATGTGG + Intergenic
917253268 1:173086451-173086473 CTGTGTCCTCACAAGCAAGAAGG + Intergenic
1063226099 10:4016414-4016436 CTGTGTCCTCGCCTGGTAGAAGG - Intergenic
1064133178 10:12728329-12728351 ATCTGTCCACGCAGCCAAGAAGG - Intronic
1072664766 10:97385003-97385025 CTGTGTCCAGGCTGCCAAGGTGG - Intronic
1078528966 11:12121673-12121695 CTGTGGCCACGATGGCCAGAGGG - Intronic
1080761512 11:35254544-35254566 CTGTTTCCAGGCAGGCAAAATGG + Exonic
1081885359 11:46491037-46491059 CTGTATCCAGGAGGGCAAGAAGG + Intronic
1083779662 11:64911267-64911289 CTCTGTCCCCTCAGGCAAGATGG - Exonic
1084887533 11:72220956-72220978 CTGGGACCACTGCGGCAAGATGG + Exonic
1089209918 11:116792750-116792772 CTGTGTCCCAGCCGGCAAGATGG + Intergenic
1092806183 12:12225206-12225228 CTGCGTCCACCCCGGCCAGGTGG - Intronic
1095181896 12:39155474-39155496 CTGGGTCCTCGCCGGGCAGAGGG - Intergenic
1106146235 13:27052401-27052423 CTGAGTCCCTGCCAGCAAGAAGG + Intergenic
1113727891 13:112618648-112618670 CTGTGTCCAGGCCCCCAAGAGGG - Intergenic
1113960916 13:114125758-114125780 CTGTGTTCACGCAGGAAAGGAGG - Intronic
1114055740 14:18965863-18965885 CTGTGTCCAGGCCAGCAAGAGGG - Intergenic
1114106807 14:19435901-19435923 CTGTGTCCAGGCCAGCAAGAGGG + Intergenic
1118964564 14:70567746-70567768 CTCTGTCCAAGCCTTCAAGAGGG + Intergenic
1121457384 14:94047059-94047081 CTGTGGGCTGGCCGGCAAGATGG + Exonic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1123499574 15:20867379-20867401 CTGTCTCCAGGCCTGCAAGAGGG + Intergenic
1123556826 15:21441109-21441131 CTGTCTCCAGGCCTGCAAGAGGG + Intergenic
1123593049 15:21878345-21878367 CTGTCTCCAGGCCTGCAAGAGGG + Intergenic
1124001546 15:25764559-25764581 CTGTCTGCAGGCCGGGAAGAGGG + Intronic
1128147881 15:65342698-65342720 CTGAGTCCACGTGGCCAAGAGGG - Intronic
1128530142 15:68439575-68439597 CTGCGTCCACGCCAGTCAGAAGG + Intergenic
1128555212 15:68627067-68627089 CTGTTTCTACGCCTGCAAAATGG + Intronic
1128808672 15:70554261-70554283 CTTTCTCCACCCCAGCAAGATGG + Intergenic
1202965169 15_KI270727v1_random:168298-168320 CTGTCTCCAGGCCTGCAAGAGGG + Intergenic
1134067683 16:11239710-11239732 CTGAGTCCCCACCAGCAAGAAGG - Intergenic
1142741854 17:1936229-1936251 CAGTGTCCACTCTGGCAAGGTGG - Exonic
1149357232 17:55852979-55853001 CTGTCTGCAAGCCAGCAAGAGGG + Intergenic
1154457633 18:14544254-14544276 CTGTCTCCAGGCCTGCAAGAGGG + Intergenic
1161914885 19:7221060-7221082 CAGAGTCCCCACCGGCAAGAAGG + Intronic
1162785095 19:13029912-13029934 CTGTGTCCATACTGCCAAGACGG + Intronic
1165006874 19:32814706-32814728 CAGTGACCACGGCGGCCAGAGGG + Intronic
1165050415 19:33137975-33137997 CTGTTTCCAGGCCTGCAAGCTGG - Intronic
1167305168 19:48703930-48703952 CCCTGTCCACTCCGGCAGGAAGG - Exonic
1167650142 19:50724414-50724436 CTGCGTCCAGGCCGGCCAGGCGG - Exonic
926226140 2:10968233-10968255 CCTTGTCCACGCCTGGAAGAGGG + Intergenic
932718502 2:74120658-74120680 CTGGGTCCAGGCAGGCAAGTGGG - Intergenic
937341426 2:121093449-121093471 CTGGGCCCATGCAGGCAAGATGG + Intergenic
937496565 2:122426410-122426432 CTGTGTCCTCACAGGCAAGAAGG - Intergenic
938337165 2:130510430-130510452 CTGTGTCCACGCCGGCAAGAGGG + Intergenic
938352672 2:130610301-130610323 CTGTGTCCACGCCGGCAAGAGGG - Intergenic
938473918 2:131590466-131590488 CTGTGTCCAGGCCGGCATGAGGG - Intergenic
938658170 2:133457148-133457170 CTGTCTCCAGGCCGGCCACATGG - Intronic
946021088 2:216640608-216640630 CAGTGTCCACACCTGCAAAATGG - Intronic
946104325 2:217355856-217355878 CTGTCTCCACACCAGAAAGAGGG + Intronic
946580010 2:221118195-221118217 CTGTCTGCAAGCCAGCAAGAGGG - Intergenic
1169850938 20:10049893-10049915 GCGTTTCCACGCCGGCAGGATGG + Exonic
1172768695 20:37364477-37364499 CTGTGTCCACCCCGTGATGAGGG + Intronic
1180474217 22:15688414-15688436 CTGTGTCCAGGCCAGCAAGAGGG - Intergenic
1181503812 22:23337486-23337508 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181708808 22:24667706-24667728 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1184097547 22:42324843-42324865 CTGGGTCCTCACCTGCAAGATGG - Intronic
1184651740 22:45922459-45922481 CTGTGTCCATGCCGCCAGGTGGG + Exonic
1184923224 22:47620247-47620269 CTGTGTCCCCGCCTGGTAGAGGG - Intergenic
959870679 3:111323896-111323918 CTGTTTCCACACCTGCAAAATGG - Intronic
961314043 3:126022436-126022458 CAGAGTCCCCGCCAGCAAGAAGG - Intronic
962970109 3:140392911-140392933 CAGAGTCCCCACCGGCAAGAAGG - Intronic
964202813 3:154137346-154137368 GAGTGTCCCCACCGGCAAGAAGG + Intronic
968672245 4:1857799-1857821 CTGTGTCCACACCGGTCAGTGGG + Intergenic
969457734 4:7309773-7309795 CTGTGTCCAGGCTGGGGAGAGGG + Intronic
985190644 4:187369174-187369196 CTGAATGCACGCCGGCAACAGGG + Intergenic
985671942 5:1211178-1211200 CTCTGTCGGGGCCGGCAAGATGG + Intronic
990413204 5:55561564-55561586 CAGTGTGCACTCAGGCAAGAAGG - Intergenic
991092120 5:62703524-62703546 CTGTGTTCACGCCGGCATCAGGG - Intergenic
992133211 5:73716277-73716299 CAGTGTCCATGCCAGCATGAAGG + Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1015159322 6:130134657-130134679 CTGTGTCTACTCCTGCCAGAAGG + Intronic
1019778676 7:2927156-2927178 CTGTGTCCACTCCGGCTGAAGGG - Intronic
1022509229 7:30924599-30924621 CTGTGTCTACACTGACAAGAGGG - Exonic
1028609944 7:92699902-92699924 CTGTTTCCTCACCTGCAAGATGG + Intronic
1029651723 7:101897974-101897996 CTGGATCCACGCAGGCAAGCTGG - Intronic
1035369950 7:158373106-158373128 CTGTGGCCACACCCCCAAGATGG + Intronic
1037446801 8:18973414-18973436 CTGTCTCCAAGCCAGTAAGAGGG - Intronic
1038581302 8:28751477-28751499 CCTTGTCCAGGCCCGCAAGAGGG - Exonic
1039280723 8:35981036-35981058 CTGTCTCCAAGCTGGCAAAAAGG - Intergenic
1039291221 8:36096168-36096190 CTGTCACCATGCCTGCAAGATGG - Intergenic
1048664419 8:136644656-136644678 CTGTATCCTCTCCGGGAAGACGG + Intergenic
1061160955 9:128893453-128893475 CTGTGTCCTCAACTGCAAGATGG - Intronic
1062290071 9:135790430-135790452 CTGTGTCCACACCTGCGGGATGG - Intronic
1062448551 9:136606000-136606022 CTGTGCCCAGGCCGGGAGGAGGG + Intergenic
1186818590 X:13262942-13262964 CTATTTCCAAGCCAGCAAGAGGG + Intergenic
1199871632 X:151903494-151903516 CTGTGACCAGGCCAGCAAGCTGG + Intergenic
1199999912 X:153054955-153054977 CTGTTTCCACCCCTGCAAGTTGG + Intergenic