ID: 938338978

View in Genome Browser
Species Human (GRCh38)
Location 2:130522998-130523020
Sequence GCGCGCGGGTGCGGGGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1067
Summary {0: 2, 1: 0, 2: 18, 3: 113, 4: 934}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938338965_938338978 18 Left 938338965 2:130522957-130522979 CCTGCGGGTCTGGGGGCGCGGGA 0: 2
1: 0
2: 0
3: 15
4: 173
Right 938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG 0: 2
1: 0
2: 18
3: 113
4: 934
938338958_938338978 30 Left 938338958 2:130522945-130522967 CCGGGTGAGGGACCTGCGGGTCT 0: 2
1: 0
2: 0
3: 13
4: 136
Right 938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG 0: 2
1: 0
2: 18
3: 113
4: 934

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938338978 Original CRISPR GCGCGCGGGTGCGGGGGCGC GGG Intronic