ID: 938339806

View in Genome Browser
Species Human (GRCh38)
Location 2:130527833-130527855
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938339806_938339813 -3 Left 938339806 2:130527833-130527855 CCTTCCGTCCTCCAGCGGGAGCG 0: 2
1: 0
2: 0
3: 5
4: 78
Right 938339813 2:130527853-130527875 GCGGCGCCCCTGCGGAAGGCCGG 0: 2
1: 0
2: 0
3: 8
4: 138
938339806_938339814 -2 Left 938339806 2:130527833-130527855 CCTTCCGTCCTCCAGCGGGAGCG 0: 2
1: 0
2: 0
3: 5
4: 78
Right 938339814 2:130527854-130527876 CGGCGCCCCTGCGGAAGGCCGGG 0: 2
1: 0
2: 0
3: 15
4: 164
938339806_938339817 4 Left 938339806 2:130527833-130527855 CCTTCCGTCCTCCAGCGGGAGCG 0: 2
1: 0
2: 0
3: 5
4: 78
Right 938339817 2:130527860-130527882 CCCTGCGGAAGGCCGGGACTTGG 0: 2
1: 0
2: 1
3: 10
4: 154
938339806_938339812 -7 Left 938339806 2:130527833-130527855 CCTTCCGTCCTCCAGCGGGAGCG 0: 2
1: 0
2: 0
3: 5
4: 78
Right 938339812 2:130527849-130527871 GGGAGCGGCGCCCCTGCGGAAGG 0: 2
1: 0
2: 0
3: 25
4: 148
938339806_938339819 5 Left 938339806 2:130527833-130527855 CCTTCCGTCCTCCAGCGGGAGCG 0: 2
1: 0
2: 0
3: 5
4: 78
Right 938339819 2:130527861-130527883 CCTGCGGAAGGCCGGGACTTGGG 0: 2
1: 0
2: 0
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938339806 Original CRISPR CGCTCCCGCTGGAGGACGGA AGG (reversed) Exonic
902229003 1:15015606-15015628 AGGTCCCACTGGAGGAGGGAGGG - Intronic
902837942 1:19058704-19058726 CGCTTGTGCTGGAGGACGGAGGG - Intergenic
922762838 1:228143074-228143096 CGCTCCCTCAGGAGGGAGGAGGG + Intronic
1071617983 10:87094250-87094272 CGCACCGGCAGGAGGCCGGAGGG + Intronic
1072633729 10:97164350-97164372 GGCTCCCGCTGGAGGCCTGGGGG + Intronic
1072787596 10:98294775-98294797 CCCTGCCCCTGGAGGAAGGAGGG + Intergenic
1075646999 10:124103162-124103184 AGCTCCCGCTGGATGGAGGACGG + Intergenic
1077136229 11:1000497-1000519 CGCTGCCGCCGGAGGAGGGTGGG - Exonic
1078315927 11:10293718-10293740 CCCTCCCGCTGGAGGCTGCAGGG - Intronic
1078798709 11:14621307-14621329 CACTCCAGCTGGGTGACGGAGGG - Intronic
1083770287 11:64863418-64863440 AGCTCCCACTGGGGGACGGCAGG - Intronic
1086225507 11:84503476-84503498 CCCTTCCACTGGAGGACTGAGGG - Intronic
1089139862 11:116276510-116276532 TGCGCCCCCTGGAGGAGGGAGGG - Intergenic
1091696334 12:2630577-2630599 TGGTCCAGCTGGAGGACTGAGGG + Intronic
1097070121 12:56348616-56348638 CTCTCTCGCTGGAGGAGGAATGG + Exonic
1101144834 12:101830978-101831000 AGCGCCACCTGGAGGACGGAGGG + Intergenic
1103829545 12:123767960-123767982 CGCTCCCTCTGCAGGACCAAGGG + Intronic
1111951603 13:94712827-94712849 CTCTCCCGCTGCTGGACTGACGG + Intergenic
1113378573 13:109784598-109784620 CGCTGCCGCTGGAGGGCCGCTGG + Exonic
1126795124 15:52254219-52254241 AGGACCCGCTGGAGGGCGGAGGG + Intronic
1136349686 16:29698814-29698836 TGTTCCCCCTGGAGGAAGGACGG - Intergenic
1136779196 16:32886269-32886291 CGCTCCAGCGGGAGGCAGGATGG + Intergenic
1136891421 16:33975249-33975271 CGCTCCAGCGGGAGGCAGGATGG - Intergenic
1142425630 16:90000875-90000897 CCCTCCCGCTGGAGGACAGTCGG + Intergenic
1203081610 16_KI270728v1_random:1148357-1148379 CGCTCCAGCGGGAGGCAGGATGG + Intergenic
1148564842 17:48626679-48626701 CCCTCCCGCTGCAGGAAGGGGGG + Intronic
1153225766 18:2898432-2898454 CTCTCCCGGTAGAGGAAGGAAGG + Intronic
1154359208 18:13645166-13645188 CGATCCCTCTGGATGAAGGACGG - Exonic
1157325697 18:46667442-46667464 AGCTTCCGCAGGAGGACAGAGGG - Intergenic
1160535897 18:79591187-79591209 AGCTGCTGCTGGAGAACGGAGGG - Intergenic
1163723460 19:18909374-18909396 GGCTCCAGCTGGAGGCTGGAGGG + Intronic
1166256118 19:41606152-41606174 ACCTCCTGCTGGAGGAGGGACGG - Intronic
1166749680 19:45158941-45158963 CGCTGCTGCTGCAGGACGGAGGG + Exonic
1166854656 19:45777558-45777580 CTCTGCCGCTGGTGGACGAAGGG - Exonic
925928177 2:8685367-8685389 CGCTGGCGCTGGAGGAGGGCGGG + Intergenic
928091835 2:28379282-28379304 CGCTCCCTCTGGAGGCCCTAGGG + Intergenic
938339806 2:130527833-130527855 CGCTCCCGCTGGAGGACGGAAGG - Exonic
938350030 2:130592917-130592939 CGCTCCCGCTGGAGGACGGAAGG + Exonic
944495950 2:200307136-200307158 CGCGCCGGCTGGAGAAAGGAAGG - Intronic
944495991 2:200307283-200307305 CGCCCGCGCGGGAGGACGGCAGG - Intronic
946082154 2:217130379-217130401 TTCTCCTCCTGGAGGACGGAGGG + Intergenic
1173189494 20:40865259-40865281 AGCTGCAGCTGGAGGACGAAGGG - Intergenic
1174531823 20:51220378-51220400 CGCGCCACCTGCAGGACGGATGG - Intergenic
1174635593 20:51996677-51996699 CGCCTGCGCTGGAGGACGTATGG + Intergenic
1175256770 20:57652531-57652553 CGCTCCCGCTGGGCGAAGGGCGG + Exonic
1179549651 21:42135766-42135788 CCCTCTCTCTGGAGGAGGGATGG + Intronic
1179798893 21:43801424-43801446 CGCGCCCGCTGGCGGATGCAGGG - Intronic
1181762941 22:25070302-25070324 CGCTCCCGCTAGAGGAAAGCTGG + Intronic
1182123195 22:27799907-27799929 CGGAGCCGCTGGAGGACGGCAGG + Exonic
1183489823 22:38110394-38110416 GGCCCGCTCTGGAGGACGGAGGG - Intronic
956701764 3:71965163-71965185 CCCTCCCCATGGAGGATGGAAGG - Intergenic
964201390 3:154122141-154122163 ATTTCCCGGTGGAGGACGGAGGG + Exonic
980966273 4:139524435-139524457 AGCTGCCACTGGAGGCCGGAGGG + Intronic
983581445 4:169313438-169313460 CGGTCCCTCTGGAGGACTCAGGG - Intergenic
988366445 5:30306463-30306485 TGTTCCCGATGGAGGATGGATGG - Intergenic
997346884 5:133198622-133198644 CGGTCCCACGCGAGGACGGATGG + Exonic
997395056 5:133553099-133553121 CGCGCCCCCTGGAGGTCAGAGGG - Intronic
997460965 5:134052099-134052121 CTTTCCCGCTGGTGGAGGGAGGG - Intergenic
1001281727 5:170390907-170390929 CGCGCCTGCTGGAGGCAGGAGGG - Intronic
1002079990 5:176732110-176732132 GGCTCCTGCTGGAGGTTGGAGGG + Intergenic
1004321952 6:14638935-14638957 CTCTCCTGCTGGAGGGTGGAGGG - Intergenic
1006353030 6:33535311-33535333 CCTTCCCACTGGAGCACGGAAGG - Intergenic
1012998245 6:105994408-105994430 CGCTTCCGCTGGAAGACGAGCGG + Intergenic
1023522097 7:41059163-41059185 CTCTCCTGCTGGAGCAAGGAGGG + Intergenic
1023623835 7:42097336-42097358 CGCTCCCCCTGGAAGATGGAGGG + Intronic
1024262036 7:47580579-47580601 CGCTGCAGCTGGAGGGTGGAGGG - Intronic
1026327999 7:69327593-69327615 TGTTCCAGCTGGAGGATGGAAGG + Intergenic
1037748855 8:21667018-21667040 AGCTCACGCTGGAGGAGGAAGGG + Intergenic
1039863094 8:41476604-41476626 CGCTCCCTCTGAAGGTGGGAGGG + Intergenic
1042071950 8:64945322-64945344 CTATCCTGCTGGAGGATGGAAGG - Intergenic
1045489358 8:102656762-102656784 GGCTCCCGCTGGAGCACGCCTGG + Intergenic
1048160175 8:132012484-132012506 CGTTACCGCTGGAGGACTAAAGG + Exonic
1053350569 9:37411031-37411053 CGCTCCCTCTGGTGGAGGGTTGG + Intergenic
1053537015 9:38936146-38936168 CGCTCCTGCTAGAGAAGGGAAGG + Intergenic
1058812269 9:108652535-108652557 CTCTCCAGCTGCAGGACTGATGG - Intergenic
1059145686 9:111897142-111897164 CGCTCCCGCAGGAGGAGGACAGG - Exonic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062288289 9:135783390-135783412 CGCTCCCTCTGGAGGCCTGGGGG - Intronic
1187172934 X:16869785-16869807 CGCAGCCGCTGGAGGAGGGAAGG + Exonic
1189655385 X:43239557-43239579 CGCTTCCGCTGCAGGAGGTAAGG - Intergenic
1195974490 X:110511485-110511507 CGCTCCCACAGGAGGTCAGAGGG + Intergenic
1198312729 X:135437035-135437057 CGCGCCCGCTGGAGGAAGCGGGG + Intergenic
1199865700 X:151848196-151848218 CTCACCCACTGCAGGACGGAGGG - Intergenic
1200100563 X:153687731-153687753 CGCTCCAGCGGGAGGCAGGATGG - Intronic
1200240110 X:154488941-154488963 GGCTCTTCCTGGAGGACGGATGG + Exonic