ID: 938343260

View in Genome Browser
Species Human (GRCh38)
Location 2:130549261-130549283
Sequence GCCATGGGCTGTGTGCTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938343260_938343264 -10 Left 938343260 2:130549261-130549283 CCCGGGAGCACACAGCCCATGGC No data
Right 938343264 2:130549274-130549296 AGCCCATGGCCCCCTGTCAGGGG No data
938343260_938343275 11 Left 938343260 2:130549261-130549283 CCCGGGAGCACACAGCCCATGGC No data
Right 938343275 2:130549295-130549317 GGCGACGGCCCGTGGGGCTACGG No data
938343260_938343272 3 Left 938343260 2:130549261-130549283 CCCGGGAGCACACAGCCCATGGC No data
Right 938343272 2:130549287-130549309 CTGTCAGGGGCGACGGCCCGTGG No data
938343260_938343280 23 Left 938343260 2:130549261-130549283 CCCGGGAGCACACAGCCCATGGC No data
Right 938343280 2:130549307-130549329 TGGGGCTACGGGGTGAGCACTGG No data
938343260_938343281 24 Left 938343260 2:130549261-130549283 CCCGGGAGCACACAGCCCATGGC No data
Right 938343281 2:130549308-130549330 GGGGCTACGGGGTGAGCACTGGG No data
938343260_938343267 -4 Left 938343260 2:130549261-130549283 CCCGGGAGCACACAGCCCATGGC No data
Right 938343267 2:130549280-130549302 TGGCCCCCTGTCAGGGGCGACGG No data
938343260_938343274 5 Left 938343260 2:130549261-130549283 CCCGGGAGCACACAGCCCATGGC No data
Right 938343274 2:130549289-130549311 GTCAGGGGCGACGGCCCGTGGGG No data
938343260_938343277 13 Left 938343260 2:130549261-130549283 CCCGGGAGCACACAGCCCATGGC No data
Right 938343277 2:130549297-130549319 CGACGGCCCGTGGGGCTACGGGG No data
938343260_938343273 4 Left 938343260 2:130549261-130549283 CCCGGGAGCACACAGCCCATGGC No data
Right 938343273 2:130549288-130549310 TGTCAGGGGCGACGGCCCGTGGG No data
938343260_938343276 12 Left 938343260 2:130549261-130549283 CCCGGGAGCACACAGCCCATGGC No data
Right 938343276 2:130549296-130549318 GCGACGGCCCGTGGGGCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938343260 Original CRISPR GCCATGGGCTGTGTGCTCCC GGG (reversed) Intronic
No off target data available for this crispr