ID: 938344756

View in Genome Browser
Species Human (GRCh38)
Location 2:130559127-130559149
Sequence GACCCTCGGCACTGAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938344756_938344765 30 Left 938344756 2:130559127-130559149 CCTCCTCCTCAGTGCCGAGGGTC No data
Right 938344765 2:130559180-130559202 GCAAACCTCACAGCACTTGACGG No data
938344756_938344760 -9 Left 938344756 2:130559127-130559149 CCTCCTCCTCAGTGCCGAGGGTC No data
Right 938344760 2:130559141-130559163 CCGAGGGTCCACCTCCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938344756 Original CRISPR GACCCTCGGCACTGAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr