ID: 938346573

View in Genome Browser
Species Human (GRCh38)
Location 2:130571461-130571483
Sequence GCCATGGGCTGTGTGCTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938346556_938346573 13 Left 938346556 2:130571425-130571447 CCCCGTAGCCCCACGGGCCGTCG No data
Right 938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG No data
938346566_938346573 -4 Left 938346566 2:130571442-130571464 CCGTCGCCCCTGACAGGGGGCCA No data
Right 938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG No data
938346552_938346573 24 Left 938346552 2:130571414-130571436 CCCAGTGCTCACCCCGTAGCCCC No data
Right 938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG No data
938346559_938346573 5 Left 938346559 2:130571433-130571455 CCCCACGGGCCGTCGCCCCTGAC No data
Right 938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG No data
938346557_938346573 12 Left 938346557 2:130571426-130571448 CCCGTAGCCCCACGGGCCGTCGC No data
Right 938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG No data
938346553_938346573 23 Left 938346553 2:130571415-130571437 CCAGTGCTCACCCCGTAGCCCCA No data
Right 938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG No data
938346558_938346573 11 Left 938346558 2:130571427-130571449 CCGTAGCCCCACGGGCCGTCGCC No data
Right 938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG No data
938346560_938346573 4 Left 938346560 2:130571434-130571456 CCCACGGGCCGTCGCCCCTGACA No data
Right 938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG No data
938346561_938346573 3 Left 938346561 2:130571435-130571457 CCACGGGCCGTCGCCCCTGACAG No data
Right 938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG No data
938346569_938346573 -10 Left 938346569 2:130571448-130571470 CCCCTGACAGGGGGCCATGGGCT No data
Right 938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938346573 Original CRISPR GCCATGGGCTGTGTGCTCCC GGG Intronic
No off target data available for this crispr