ID: 938350860

View in Genome Browser
Species Human (GRCh38)
Location 2:130597752-130597774
Sequence GCGCGCGGGTGCGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1067
Summary {0: 2, 1: 0, 2: 18, 3: 113, 4: 934}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938350860_938350880 30 Left 938350860 2:130597752-130597774 CCCGCGCCCCCGCACCCGCGCGC 0: 2
1: 0
2: 18
3: 113
4: 934
Right 938350880 2:130597805-130597827 AGACCCGCAGGTCCCTCACCCGG 0: 2
1: 0
2: 0
3: 13
4: 136
938350860_938350873 18 Left 938350860 2:130597752-130597774 CCCGCGCCCCCGCACCCGCGCGC 0: 2
1: 0
2: 18
3: 113
4: 934
Right 938350873 2:130597793-130597815 TCCCGCGCCCCCAGACCCGCAGG 0: 2
1: 0
2: 0
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938350860 Original CRISPR GCGCGCGGGTGCGGGGGCGC GGG (reversed) Intronic