ID: 938350860 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:130597752-130597774 |
| Sequence | GCGCGCGGGTGCGGGGGCGC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 1067 | |||
| Summary | {0: 2, 1: 0, 2: 18, 3: 113, 4: 934} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938350860_938350880 | 30 | Left | 938350860 | 2:130597752-130597774 | CCCGCGCCCCCGCACCCGCGCGC | 0: 2 1: 0 2: 18 3: 113 4: 934 |
||
| Right | 938350880 | 2:130597805-130597827 | AGACCCGCAGGTCCCTCACCCGG | 0: 2 1: 0 2: 0 3: 13 4: 136 |
||||
| 938350860_938350873 | 18 | Left | 938350860 | 2:130597752-130597774 | CCCGCGCCCCCGCACCCGCGCGC | 0: 2 1: 0 2: 18 3: 113 4: 934 |
||
| Right | 938350873 | 2:130597793-130597815 | TCCCGCGCCCCCAGACCCGCAGG | 0: 2 1: 0 2: 0 3: 15 4: 173 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938350860 | Original CRISPR | GCGCGCGGGTGCGGGGGCGC GGG (reversed) | Intronic | ||