ID: 938352858

View in Genome Browser
Species Human (GRCh38)
Location 2:130611316-130611338
Sequence GCCCTTCCTCGGGTGGGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 2, 1: 4, 2: 7, 3: 17, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938352839_938352858 18 Left 938352839 2:130611275-130611297 CCTTGGGTGGGCTGGGTGTTTTC 0: 4
1: 3
2: 3
3: 29
4: 225
Right 938352858 2:130611316-130611338 GCCCTTCCTCGGGTGGGCGTGGG 0: 2
1: 4
2: 7
3: 17
4: 154
938352838_938352858 19 Left 938352838 2:130611274-130611296 CCCTTGGGTGGGCTGGGTGTTTT 0: 5
1: 3
2: 0
3: 20
4: 185
Right 938352858 2:130611316-130611338 GCCCTTCCTCGGGTGGGCGTGGG 0: 2
1: 4
2: 7
3: 17
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938352858 Original CRISPR GCCCTTCCTCGGGTGGGCGT GGG Intergenic