ID: 938359895

View in Genome Browser
Species Human (GRCh38)
Location 2:130678757-130678779
Sequence GAGAATGGGGAGCACAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938359895_938359905 10 Left 938359895 2:130678757-130678779 CCAGCCTTGTGCTCCCCATTCTC No data
Right 938359905 2:130678790-130678812 CTTTTCCAGTGTCAGCCAGCAGG No data
938359895_938359906 11 Left 938359895 2:130678757-130678779 CCAGCCTTGTGCTCCCCATTCTC No data
Right 938359906 2:130678791-130678813 TTTTCCAGTGTCAGCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938359895 Original CRISPR GAGAATGGGGAGCACAAGGC TGG (reversed) Intergenic
No off target data available for this crispr