ID: 938360151

View in Genome Browser
Species Human (GRCh38)
Location 2:130679967-130679989
Sequence TCTGAGATGCAGGTGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938360151_938360162 19 Left 938360151 2:130679967-130679989 CCTGGCACCACCTGCATCTCAGA No data
Right 938360162 2:130680009-130680031 TACCCAGAGGACAGCAGGCCTGG No data
938360151_938360159 6 Left 938360151 2:130679967-130679989 CCTGGCACCACCTGCATCTCAGA No data
Right 938360159 2:130679996-130680018 GTGGCACACTCCTTACCCAGAGG No data
938360151_938360160 14 Left 938360151 2:130679967-130679989 CCTGGCACCACCTGCATCTCAGA No data
Right 938360160 2:130680004-130680026 CTCCTTACCCAGAGGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938360151 Original CRISPR TCTGAGATGCAGGTGGTGCC AGG (reversed) Intergenic
No off target data available for this crispr