ID: 938361862

View in Genome Browser
Species Human (GRCh38)
Location 2:130693665-130693687
Sequence CCTGGCCTCGGGCTCGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938361850_938361862 8 Left 938361850 2:130693634-130693656 CCCGCACGCTGTTGAGGTAGTCG 0: 1
1: 2
2: 3
3: 1
4: 23
Right 938361862 2:130693665-130693687 CCTGGCCTCGGGCTCGGCGCGGG No data
938361848_938361862 19 Left 938361848 2:130693623-130693645 CCGAATGGAGTCCCGCACGCTGT No data
Right 938361862 2:130693665-130693687 CCTGGCCTCGGGCTCGGCGCGGG No data
938361851_938361862 7 Left 938361851 2:130693635-130693657 CCGCACGCTGTTGAGGTAGTCGT 0: 1
1: 3
2: 0
3: 1
4: 28
Right 938361862 2:130693665-130693687 CCTGGCCTCGGGCTCGGCGCGGG No data
938361846_938361862 28 Left 938361846 2:130693614-130693636 CCCTGTGGACCGAATGGAGTCCC No data
Right 938361862 2:130693665-130693687 CCTGGCCTCGGGCTCGGCGCGGG No data
938361847_938361862 27 Left 938361847 2:130693615-130693637 CCTGTGGACCGAATGGAGTCCCG No data
Right 938361862 2:130693665-130693687 CCTGGCCTCGGGCTCGGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938361862 Original CRISPR CCTGGCCTCGGGCTCGGCGC GGG Intergenic
No off target data available for this crispr