ID: 938367676

View in Genome Browser
Species Human (GRCh38)
Location 2:130747686-130747708
Sequence CTCCAGCCACTGTTCAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938367676_938367678 24 Left 938367676 2:130747686-130747708 CCTGTGTTGAACAGTGGCTGGAG No data
Right 938367678 2:130747733-130747755 AGCGTAAGTCAGTCACTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938367676 Original CRISPR CTCCAGCCACTGTTCAACAC AGG (reversed) Intergenic
No off target data available for this crispr